Noggin2-based activin activity blocking method

FIELD: chemistry.

SUBSTANCE: invention refers to biotechnology, specifically to Noggin2 proteins and can be used in medicine. The signalling cascade activin is blocked by introducing Noggin2 in an organism, tissue or cell in amount effective to inhibit or decrease activin activity.

EFFECT: invention allows blocking effectively activity of protein activin.

2 dwg, 8 ex

 

The scope of the invention

This invention relates to proteins that regulate cell differentiation by inhibiting proteins of the superfamily of TGF-β.

Prior art

The superfamily of transforming growth factor P (TGF-P) includes many growth factors that share common structural motifs. Data proteins involved in a wide range of biological processes, such as processes of cell and tissue differentiation during embryonic development and wound healing, restoration and reconstruction of bone tissue in the adult body. Identified a number of proteins of the extracellular matrix, which are antagonists of the various members of the superfamily of TGF-β (e.g., proteins of bone morphogenesis, BMP) and play an important role in the processes of cellular differentiation and development (Balemans and Van Hul, Dev Biol. (2002) 250 (2):231-250; Avsian-Kretchmer and Hsueh, Mol Endocrinol. (2004) 18(I):1-12). The BMP antagonists include, for example, proteins hordin, intropin, noggin, Cerberus and follistatin.

For example, proteins Cerberus and noggin vertebrate induce the formation of structures of the head in the anterior ectoderm of embryos of vertebrates. Protein noggin are capable to change the differentiation of mesoderm precursors of the ventral primordia, such as blood and mesenchyme, in dorsal rudiments, such as muscle or chord, or differential is the epidermal precursors in the embryonic neural. Function hardina similar to functions noggin, reflecting a similar mechanism of action of these proteins as BMP antagonists.

Antagonists of growth factors from the superfamily of TGF-β are important pharmaceutical, clinical, and laboratory instruments for the regulation of cellular differentiation and therapeutic intervention.

Recently in vertebrates has been described a new homologue of the protein noggin called noggin (Fletcher et al., Gene Expr Patterns. 2004, v. 5(2), pp.225-230). It was shown that the gene noggin has a differential expression pattern during development of Xenopus. However, the function noggin not investigated. The present invention relates to functions noggin.

The invention

The authors of the present invention discovered that noggin plays a role in the regulation of cellular differentiation and is an antagonist of some members of the superfamily of TGF-p In this range and nature of the action noggin different from those noggin (formerly "noggin"). In particular, unlike noggin, noggin does not induce the development of muscle tissue from embryonic ventral mesoderm. In addition, it may prevent a well-known activity noggin in relation to the induction of muscle development. At the same time, like noggin, noggin can induce the development of nervous tissue from embryonic ectoderm. Thus, noggin has a unique izbirateljnostj in relation to the induction of the development of the nervous tissue.

The ability to identify noggin to inhibit the differentiation of muscle tissue due to its ability to inhibit the overall differentiation of embryonic mesoderm due to interaction with other (wider) range of factors from the superfamily of TGF-β. Along with inhibition epidermolysis activity of BMP2, VMR or VMR, which, as you know, is also inhibited by noggin, noggin has the ability to inhibit the activity of such inductor embryonic mesoderm, as activin.

The present invention relates to methods and compositions that use noggin or encodes its nucleic acid.

In the preferred implementation of the present invention relates to a method of reducing or blocking the activity of specific noggin targets (e.g., BMP2, VMR, VMR, activin, or a combination of them) in an organism, tissue or cell, introducing noggin in the specified organism, tissue or cell in an amount effective for inhibiting or reducing the activity of specific noggin targets by preventing the binding of the target or their fragments with specific protein receptors.

In the preferred implementation of the method and compositions are used for the modification of cellular differentiation, where the specified method envisage which involves bringing the cells or surrounding the cell environment in contact with the protein noggin in such conditions, when noggin specifically interacts with its target components of the environment and/or cell surface for modification of cellular differentiation.

In one preferred implementation uses exogenous protein noggin; in another preferred implementation uses expressing the construct containing the coding noggin nucleic acid under the control of a suitable promoter. In this implementation of the method of changing cellular differentiation involves the creation of expressing constructs containing the coding noggin nucleic acid under the control of a suitable promoter; introducing a specified expressing constructs into the cell for expression noggin or functional chimeric protein containing noggin, where expression noggin or specified chimeric protein leads to changes in cell differentiation.

Brief description of figures

Figure 1 presents the difference between the effects noggin and noggin on the differentiation of nerve and muscle tissues in embryos of Xenopus laevis and their tissue explants. (A) the hybridization signal 1 l situ is shown in black.

(A, B). Ventral microinjection 40 PG of synthetic mRNA gene noggin in embryos of X. laevis early development lead to the formation of a secondary axis of the body (black arrow indicates the main OS the body, the gray arrow indicates the secondary axis of the body), while microinjection of the same amount of synthetic mRNA noggin leads to the formation of mushroom-like phenotype (A: 80%, for a total of 68 germ of 85; B: 90%, for a total of 68 germ of 75).

(IN-W). In situ hybridization of control embryos (left on each of their photos) and germ, microinjection mRNA noggin with mRNA samples given genetic markers shows an increase in neural (C, D) and suppression of epidermal (E) and mesoderm (E, W) differentsirovat. The signal is shown in black.

(C). The explants ventral marginal zone (VMZ) embryos, microinjection ventral RNA noggin extended to the end of neuroscie due to the differentiation of skeletal muscle.

(And). The explants ventral marginal zone (VMZ) embryos, microinjection ventral RNA noggin to the end of neuroscie retain the round shape.

(To). The scheme of experiments with the ectoderm explants animal region of the embryo (animal beanies - AC) and explants ventral marginal zone of the embryo (VMZ).

(L). Reverse transcription - PCR analysis of samples of total RNA explants of the animal cap ectoderm region of embryos and explants ventral marginal zone of the embryo, microinjection mRNA noggin and noggin with primers to neuroectodermal the m (NCAM, Xanf-1), epidermal (keratin), muscle (α-actin), posteriora mesoderm (brachyury) and endomesoderm (cerjberus) molecular markers and Ef-1α as control the amount of mRNA. Noggin and noggin activate the expression of neural markers (NCAM, Xanf-1) and inhibit the expression of epidermal (keratin), while only mRNA noggin discovers the ability to activate the expression of muscle molecular marker α-actin in explants of ventral marginal zone.

Figure 2 presents the difference between the effects noggin and noggin on gene expression jbrachyury, BF-1 and Pax-6 and below analyses the ability of the protein noggin contact with BMP-4 and activin. (A-E) results of in situ hybridization of total preparations of Xenopus laevis embryos with probes corresponding to genes (signal in situ hybridization is shown in black); (A'-E') - the same embryo shown under UV lighting that allows you to visualize microinjection cells, in addition to containing mRNA tag - fluorescein-lysine-dextran (FLD).

(A, A'). Suppression of the expression of mesoderm marker molecule (brachyury) in embryos, microinjection mRNA noggin. And' green fluorescent dye shows the distribution microinjection material.

(B, B'). The expression of mesoderm marker molecule (brachyury) in embryos, microinjection mRNA noggin not obnarujivayut changes compared with the control embryo (arrow).

(B, B', D, D'). The formation of a secondary axis of the body from germs, microinjection 2-5 ng of mRNA noggin in one of ventral blastomeres. The existence of the expression of molecular markers BF-1 and Pax-6 indicates the presence of additional axes prednisolone and ocular structures.

(G, G', E, E'). The secondary axis of the body, formed by a microinjection 40 ng of mRNA noggin in one of ventral blastomeres of the embryo does not contain prednisolone and ocular structures.

(W). Protein noggin exhibits the ability to bind molecules of bone morphogenetic protein (BMP) and activin molecules. Detailed description of the experiments given in the text examples 4 and 5.

(C). Protein noggin shows the ability to inhibit the phosphorylation of intracellular transmitters signals BMP, activin - protein Smad1 and Smad2, respectively. Detailed description of the experiments given in the text examples 4 and 5.

Detailed description of the invention

Used herein, the term "ortholog" refers to a polypeptide or protein obtained from one species that is the functional copy of the polypeptide or protein of another species. Differences in the sequences of orthologues are the result of speciation.

Used herein, the term "homologue" or "homology" is a term used in this field to describe the relationship of nucleotide or alcoholdependent another nucleotide or protein sequence, determined by the degree of identity and/or similarity between the compared sequences.

As summarized above, the disclosed methods of changing the activity of certain members of the superfamily of TGF-J3, as well as compositions containing protein noggin encoding its nucleic acid or antibodies against noggin for use in them. These methods and compositions for their practical application can be used in a number of research, diagnostic or therapeutic applications, including as non-limiting examples, the inhibition or reduction of inflammation; the regulation of the reconstruction of the bone in the adult skeleton; prevention and treatment associated with BMP and activin disorders in animals, particularly humans; study and treatment of heart disease and neurological disorders.

The present invention relates to the use of specific functions noggin. For example, protein noggin from Xenopus laevis with the amino acid sequence shown in SEQ ID NO: 2, the authors discovered that noggin plays a role in the regulation of cell differentiation and the action and special targets for binding different from noggin and other known antagonists of growth factors belonging to the superfamily of TGF-P. unlike noggin noggin suppresses total differentiation of embryonic IU is termi, inhibiting the action of the inducer of mesoderm - activin.

At the same time, like noggin, noggin induces the development of nervous tissue from embryonic ectoderm. Thus, noggin has a unique selective activity against induction of the development of the nervous tissue. The ability to identify noggin to prevent dorsalize activity noggin is the result of his ability to make contact with some non-BMP2, VMR or VMR, reliably communicating with noggin, representatives of the superfamily of TGF-β. In particular, additional factors TGF-β binding to noggin are activin and related proteins required for the induction of the muscle of the embryonic mesoderm.

Used herein, the term "noggin" means a protein having the only and selective activity against the induction of the development of the nervous tissue, bind with specific noggin targets for binding selected from the group consisting of BMP2, VMR, VMR and activin or combinations thereof, and which is the homologue and the ortholog proteins noggin selected from the group consisting of noggin Xenopus laevis; noggin Xenopus tropicalis; noggin Fugu rubripes; noggin Gallus gallus (SEQ ID NO: 2, 4, 6, 8). Noggin mammals, including human noggin represents a particular interest.

Specific to noggin activity or function can be determine through the m known approaches of cell biology in systems in vitro or in vivo, for example, analyses of binding in vitro assays in cell culture, animals (e.g., immune response, gene therapy, transgenic animals, and so on) and other Analyses of binding include any analysis where we evaluate the specific molecular interaction noggin with target binding. The target for binding can be a natural target for binding or non-natural target for binding, such as a specific immune protein such as an antibody. Typically, the binding specificity assessed by biological analysis (for example, the capacity for induction of neural tissue from injected embryonic ectoderm) or determination of the binding constants noggin with his targets of the superfamily of TGF-β, etc.

Under the homologue protein mean protein, amino acid sequence which is at least about 68%, usually at least about 75% and most often at least about 85% identical to known amino acid sequences noggin shown in SEQ ID NO: 2, 4, 6, 8, as determined using the algorithm in MegAlign, DNAstar clustal algorithm as described in D.G. Higgins and P.M. Sharp, "Fast and Sensitive multiple Sequence Alignments on a Microcomputer", CABIOS, 5 pp.151-3 (1989) (with application settings multiplicity 1, the penalty for pass 3, box 5 and diagonals saved 5). In many done is also of interest homologues have much greater sequence identity, for example, 90% (e.g., 92%, 93%, 94%) or higher, for example, 95%, 96%, 97%, 98%, 99%, 99,5%, especially for the sequence of amino acids forming the functional region of the protein.

Also of interest are proteins, largely identical proteins noggin, with amino acid sequences of SEQ ID№№2, 4, 6, 8, where significant identity implies that the amino acid sequence of the protein is identical with the sequence specified protein at least about 68%, usually at least about 75% and most often at least about 80%, where in some cases, the identity may be more than, for example, 85%, 90%, 95% or more.

Interest proteins include naturally occurring proteins and recombinant proteins containing the amino acid sequence noggin or functional protein domains with determinable by analysis of the specific activity noggin. Thus, proteins can be a deletion mutant of natural proteins noggin, and you can get them in the form of hybrid products containing polypeptides noggin or functional protein domains. Interest fragments are polypeptides, typically, a length of at least about 30 amino acids, as a rule, lineup least about 50 amino acids, preferably a length of at least approximately 75 to 100 amino acids and can range in length up to 300 amino acids or more, but usually do not exceed the length of 250 amino acids, where the fragment contains a stretch of amino acid sequence identical considered a squirrel, a length of at least about 25 amino acids, usually at least 45 amino acids, and in many implementations, at least 50 amino acids. In some implementations considered polypeptides comprise a length of approximately 25 amino acids, about 50, about 75, about 100, about 125, about 150, about 200, or about 250 amino acids, up to the full-size protein. Interest fragments retain all or essentially all of the specific function of the protein of the wild type.

Also of interest are proteins, derivatives or mutants of naturally occurring proteins with specific activity noggin. Mutants and derivatives can preserve the biological properties of proteins wild-type (e.g., naturally occurring) or may have biological properties that are different from those of proteins of the wild type. The term "biological property" of the proteins of the present invention relates to biochemical properties, such as the camera shall lnost in vivo and/or in vitro (e.g., the half-life); the rate of maturation, the ability to aggregate or to the formation of oligomers and other such properties, but is not limited to them. Mutations include substitutions of individual amino acids, deletion or insertion of one or several amino acids, shortening or lengthening the N-end shortening or lengthening of the C-end, etc.

Also of interest is the coding noggin nucleic acid containing a nucleic acid selected from the group consisting of SEQ ID NO: I, 3, 5, 7; nukleinovykh acids, substantially identical to the specified nucleic acids and their mutants, derivatives and homologues. Nucleic acids encoding proteins noggin mammals (e.g. human noggin), are of particular interest.

Under the homologue nucleic acid is meant a nucleic acid that is identical to the corresponding nucleotide sequence of at least about 30%, and preferably approximately 40%, 50%, 55%, 60%, 65%, 70% or higher, including 75%, 80%, 85%, 90% and 95% or higher. The control sequence is long, typically at least about 30 nucleotides, more often at least about 60 nucleotides, and can reach a length of the complete sequence to be compared. Sequence similarity calculated based acontrolling sequence. In this area known such algorithms for sequence analysis, as BLAST, described in Altschul et al., J. Mol. Biol., 215, pp.403-10 (1990) (for example, using the default values, ie, the parameters w=4 and T=17).

The source of homologous nucleic acids and protein may be any type of plants or animals, or the sequence can be completely or partially synthesize include analogs of nucleic acids.

Mutants or derivatives of proteins and nucleic acids noggin can be formed using standard methods of molecular biology to the matrix nucleic acid that encodes a protein noggin through changes, deletions or additions of one or several nucleotides matrix sequences or combinations thereof, for educational options matrix nucleic acid. Substitutions, additions or deletions can be made by any known in this field (see, for example, Gustin et al., Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123 and Colicelli et al., Mol. Gen. Genet. (1985) 199:537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp.15.3-15.108), representing PCR errors, permutation, oligonucleotide-directed mutagenesis, Assembly PCR, mutagenesis by sexual PCR mutagenesis in vivo, cassette mutagenesis, recursive group mutagenesis, exponential group mutagenesis, site-directed mutagenesis, Slu is any mutagenesis, the rearrangement of genes, saturating mutagenesis of gene sites (GSSM), the permutation artificial legirovaniem (SLR), or a combination thereof.

Substitutions, additions or deletions can also be entered by a method comprising recombination, recursive recombination sequences, mutagenesis using the modified phosphothioate DNA mutagenesis using containing uracil matrix, mutagenesis using the duplex gap, mutagenesis using repair spot inconsistencies, mutagenesis using strain-owner with failure recovery system, chemical mutagenesis, radiogenic mutagenesis, mutagenesis by deletion mutagenesis with the use of restriction-selection mutagenesis using restriction-purification, synthesis of artificial genes, group mutagenesis, creating multimeric chimeric nucleic acid and a combination thereof.

In addition, can be obtained degenerate variants encoding proteins noggin nucleic acids. Degenerate variants of the nucleic acids contain replacement codons of the nucleic acid to other codons encoding the same amino acids. Specifically, degenerate variants of the nucleic acid get to enhance their expression in the cell host. In this implementation of the codons of the nucleic acid, non-preferred or less preferred is compulsory in the genes of the host cell replaces most represented in coding sequences in the host cell codons, where these substituted codons encode the same amino acid.

Derivatives can also be obtained using standard methods, including modification of RNA, chemical modification, post-translational and posttranscriptional modifications, etc. for Example, derivatives can be obtained using methods such as changing the profile of phosphorylation or glycosylation, or acetylation or lipidization or using different types of cleavage Mature forms, etc.

Interest proteins and fragments are selected, i.e. exist outside of the natural environment. The considered proteins and protein domains can be synthesized or obtained by recombinant technology, or select from their natural environment. For biochemical synthesis, molecular expression and purification of these compositions there are many molecular and biochemical methods, see, for example, Molecular Cloning, A Laboratory Manual (Sambrook, et al., Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY).

In the preferred implementation of the proteins of the present invention are recombinant proteins, obtained using standard approaches using coding noggin nucleic acid, for example, a nucleic acid selected from the group consisting of SEQ ID NO: I, 3, 5 or 7.

KJV is inema here, the nucleic acid molecule is a DNA molecule, such as molecules of genomic DNA or cDNA molecules or RNA molecules, such as mRNA molecules. Specifically, these nucleic acid molecules are molecules of cDNA with an open reading frame encoding a protein noggin of the present invention or a functional fragment and is capable, under the right conditions to be expressed as an active noggin or functional domain noggin of the present invention.

Interest genomic sequence can contain nucleic acid located between the initiating codon and the stop codon, as defined in the listed sequences, including all introns, normally present in the original chromosome. Interest genomic sequence may include 5'- and 3'-noncoding region, located in the Mature mRNA, as well as specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc. including approximately 1 TPN, but possibly more, of flanking genomic DNA or 5'- or 3'-end of the transcribed region.

Consider the nucleic acid can be selected and obtained in substantially purified form. The term "substantially purified form" means that the nucleic acids are at least p is blithedale 50% pure, typically at least 90% pure, as a rule, are "recombinant", i.e. flanked by one or more nucleotides with which they do not normally associated in the natural chromosome in a natural body of the host.

Nucleic acids of the present invention, the corresponding cDNA, full-length genes and designs can be obtained artificially by means of different protocols known to specialists in this field. Appropriate design of nucleic acids purified using standard methods of recombinant DNA, for example, as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2ndEd., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and as described, for example, in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.

Also of interest are chimeric proteins containing noggin or its fragments, fused, for example, with a sequence of degradation, signaling protein, or any protein or polypeptide of interest. Slit proteins may include, for example, protein noggin and second polypeptide (the"merger partner"), merged into a single reading frame at the N-end and/or the end of the polypeptide noggin. Partners for mergers include as non-limiting examples of polypeptides that can bind antibodies that are specific to the partner in the merger (for example, petopia marks) antibodies or their binding domains, polypeptides that provide a catalytic function or induction of a cellular response, ligands or receptors or their mimetics, etc. In such fused proteins partner in the merger, as a rule, associated with a part of the hybrid protein, which protein noggin, unnatural way and, as a rule, is not a protein noggin of the present invention or a derivative/fragment. Also of interest are nucleic acids encoding the hybrid proteins described above.

Also disclosed vector and other structures of nucleic acids containing the coding noggin nucleic acid. Applicable vectors include viral and non-viral vectors, plasmids, Comedy, phages, etc., preferably plasmids, and they are used for cloning, amplification, expression, transfer, etc. nucleic acid sequence according to the present invention in a suitable host. The choice of a suitable vector are well known to the person skilled in the art, and many such vectors are commercially available. To obtain structures of partial or full-sized nucleic acid is inserted into the vector, usually by incorporating a DNA ligase to split the enzyme restriction site in the vector. Alternatively, the desired nucleotide sequence can be embedded through the om homologous recombination in vivo, as a rule, through connection to a vector on each side of the desired nucleotide sequence of the regions of homology. For example, a region of homology added by ligating nucleotide or by polymerase chain reaction using primers that contain a region of homology and part of the desired nucleotide sequence.

Also disclosed expressing cassettes or system, among other things, used to obtain protein noggin or hybrid protein or for replication of the nucleic acid molecules of the present invention. Expressing cassette may exist as an extrachromosomal element or it can be integrated into the host cell genome as a result of the introduction of the specified cartridge in the cell. For the expression of the gene product encoded by a nucleic acid according to the invention Express in expressing any suitable system, including, for example, bacterial, yeast systems, insects, amphibians or mammals. In expressing the vector nucleic acid according to the invention is functionally associated with a regulatory sequence that can include promoters, enhancers, terminators, operators, repressor substances and inductors. Ways to get expressing cassettes or systems that can Express the desired product, well-known the s specialists in this field.

Cell lines stably expressing noggin, it is possible to select by means well known in the field of methods (e.g. co-transfection with a selective marker such as dhfr, gpt, neomycin, hygromycin providing identification and selection of transfected cells containing the gene integrated into the genome).

Above expressing the system can be used in prokaryotic or eukaryotic hosts. To get protein, you can use these cells-the hosts as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of higher organisms such as vertebrates, such as COS7 cells, NEC, SNO, Xenopus oocytes, etc.

When for replication and/or expression of nucleic acids according to the invention apply any of the above host cells or other applicable cell owners or organisms owners resulting from the replicated nucleic acid is expressed protein or polypeptide fall under the scope of the invention as a product of the host cell or the host body. The product can highlight any known in the field appropriate ways.

Also disclosed are antibodies, specific binding with noggin of the present invention. Applicable antibodies can be obtained by applying known in this region the STI methods. For example, polyclonal antibodies can be obtained, as described in Harlow and Lane Antibodies: A Laboratory Manual, (1988) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, and monoclonal antibodies can be obtained, as described in Coding, Monoclonal Antibodies: Principles and Practice: Production and Application of Monoclonal Antibodies in Cell Biology, Biochemistry and Immunology; 3rd edition, (1996) Academic Press. Also of interest hybrid antibodies, including humanized antibodies and single-chain antibodies and such antibody fragments as Fv, F(ab')2and Fab.

Noggin, as well as other above-described components of the present invention find use in many different applications, including use as immunogens, targets in screenrush analyses, biologically active substances to modulate cell growth, differentiation and/or function, etc.

In the preferred implementation of the present invention relates to a method of reducing or inhibiting the activity of specific noggin targets (e.g., BMP2, VMR, VMR, activin, nodal, or a combination of them), providing for the introduction noggin in the specified organism, tissue or cell in an amount sufficient for inhibiting or reducing the activity of specific noggin targets through obstacles to linking these targets or their fragments with specific protein receptors.

In prefer Inom the implementation of the presented methods and compositions are used for the modification of cellular differentiation. In particular, the modification of cellular differentiation involves the conversion of a cell or environment of the cell environment in contact with the protein noggin in conditions when noggin specifically interacts with its target components of the environment and/or cell surface to effect the change in cell differentiation.

In one preferred implementation uses exogenous protein noggin; in another preferred implementation uses expressing the construct containing the coding noggin nucleic acid under the control of a suitable promoter. Protein noggin can be added to the in vitro cultivation and physiological fluids, such as blood, synovial fluid, etc. of the Protein can also enter or to Express in specific populations of cells in any suitable way, such as microinjection, dependent on promoter expression of the recombinant enzyme, targeted delivery of lipid particles, etc. these methods can be used to reduce unwanted osteogenesis, inhibiting growth of cells that require morphogenetic protein (for example, dependent BMP neuroblastoma and glioma), regulation of the formation and growth of cartilage, changes dependent morphogen directions of development/differentiation of cells in culture, such as CL the TCI for transplantation or infusion, etc. As noggin causes the activity in relation to the induction of neural tissue, it can be applicable for the treatment of peripheral neuropathy with the growth of the spinal cord and processes sensitive neurons, for example, it can be included in therapeutic treatment for the regeneration processes of the neurons after stroke, brain damage caused by head injuries, and paralysis caused by spinal cord injuries. The application can also consist in the treatment of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and multiple sclerosis, by stimulating the processes of neurons. Additional applications may include restoration of cut axons, which often occurs in the tissue lesions in multiple sclerosis.

As the antagonist of a number of growth factors (e.g., BMP2, VMR, VMR, activin, or a combination of them) noggin or its fragment is used as the suppressor activity of these factors, such as bone morphogenetic protein (BMP), activin, or their orthologues. Preferably, the invention relates to a method of counteracting the functioning of the abovementioned specific targets, providing reduction of the specified target in contact with the protein noggin or its fragment. The method according to the invention is carried out in conditions when noggin or its fragment tie the season with a specific target. As an antagonist of BMP noggin can be used for prevention or treatment associated with BMP disorders in animals, particularly in humans. For example, noggin can be used for the treatment of diseases or disorders that include as non-limiting examples of progressive references for additional information fibrodysplasia (FOP), as well as for the treatment of abnormal bone growth, such as abnormal bone growth after surgery replacement hip joint replacement, trauma, burns, or damage to the spinal cord. In addition, noggin can be applicable for the treatment or prophylaxis of adverse effects of BMP associated with abnormal bone growth observed in connection with metastatic prostate cancer or osteosarcoma. Since it is known that the contents of the ligands BMP2 and VMR significantly increased in asthma (Rosendahl et al., Am J Respir Cell Mol Biol. 2002 Aug; 27(2):160-9) and some other inflammatory diseases, in particular rheumatoid arthritis (Lories et al., Arthritis Rheum. 2003 Oct; 48 (10):2807-18.), then noggin can also be used to bind BMP and, thus, for the treatment of inflammatory syndromes.

As noggin can bind activin, he also finds application for the prevention and treatment related to activin diseases, for example for inhibiting the progression of chronic renal failure, acute pacec the second failure, pancreatitis and bronchopulmonary dysplasia of newborn etc. it can Also be applied to the eye injury, such as trauma to the corneal burns or penetration of foreign body or inflammatory eye diseases such as uveitis.

In addition, nucleic acids, proteins, and fragments noggin according to the invention can be used for modifying the activity of specific noggin targets in animals, particularly in humans.

Interest compositions can include protein noggin, such as purified recombinant protein or chimeric protein containing noggin, or functional fragment noggin. These compositions can also include a nucleic acid encoding a protein noggin able to Express the protein noggin in the interest of the cells, tissues, organs or organisms. These compositions may also contain suitable pharmaceutical carrier for systemic or local injection in vivo in any suitable way, including as non-limiting examples of injection (e.g. intravenous, intraperitoneal, intramuscular, subcutaneous, endoneural, perineurally, intraspinal, intraventricular, intravitreal, intrathecal, etc.), by absorption through epithelial or Muco-cutaneous mucosa (for example, through the oral mucosa of Palast is, rectal and intestinal mucosa, etc.) or implants with a slow release, including cellular or tissue implants. Depending on ways of introduction of the composition may contain a liquid carrier, such as saline, to be enclosed in liposomes, microcapsules, polymer or based on paraffin drugs controlled release, or may be formulated in the form of tablets, pills or capsules. The concentration of the applied active ingredient(s) depends on the type of disease or traits that are affected by the applied way of introduction, as well as on the characteristics of biological systems. Effective dose can be obtained by extrapolation of the curves of the dose-response obtained in test systems in vitro or in animal models.

Used herein, the term "effective dose" means the amount of protein required to achieve a biological effect, i.e. the suppression of the functions of the above representatives of the superfamily of TGF-beta. A biological effect may be the reduction of signs, symptoms or the cause of the disease or any other changes in biological systems. Usual effective dose is in the range from 0.1-100 mg/kg of the subject.

The introduction could lead to the distribution of noggin in the body or in l is kalitvinoj area. For example, in many States, involving the distal region of the nervous system, it is possible to apply intravenous or intrathecal noggin. An alternative, and not as limitations involved when a localized area of the nervous system, it is possible to apply a local introduction. In such situations in a specific area or near it, you can place containing noggin implant. Suitable implants include as non-limiting examples of gelatin sponge, wax or implants, based on the microparticles.

The following examples are offered to illustrate but not to limit.

Example 1

Cloning of cDNA noggin

cDNA noggin cloned during a search for genes of Xenopus laevis involved in the regulatory network homeobox-containing gene Xanf-1 (Zaraisky et al. Developmental Biology 1992, v.152, pp.373-382; Ermakova et al., Development 1999, v. 126, pp.4513-4523). To identify genetic targets Xanf-1 the authors conducted a subtractive hybridization cDNA samples obtained from explants of the anterior ectoderm of the two groups of Xenopus embryos: in one group broadcast Xanf-1 and its pseudoallele in Xenopus laevis, Xanf-2 decreased with the use of microinjection of 1 mm Martinovich oligonucleotides against Xanf-1 (5'-ATCCTTTCTGAAGAGCAGGAGACAT and 5'-ATCCTTTCTGGAGACCAGTAGACAT, Gene Tools); in the other group in embryos by microinjection were injected control morpholino oligonucleic the water (MO), provided by Gene Tools Co. In Xenopus laevis embryos at stage two blastomeres at the animal pole of both blastomeres were performed microinjections MO against Xanf or control MO, mixed with the vital dye fluoresceinisothiocyanate (FLD). For each of the two types of embryos at the stage of secondary narula, as described in the Zaraisky et al. Developmental Biology 1992, v.152, pp.373-382, cut out approximately 30 explants front neuroectoderm, taken together with the sea endomesoderm. The operation was chosen only those embryos that had uniform FLD signal in the anterior region. Subtractive hybridization and differential screening was performed using a set of reagents PCR-Select kit (BD Clontech). The cDNA insert of all differentially distributed clones (approximately 50) sequenced and analyzed online using the programs BLAST database GeneBank and JGI. The result identified a clone containing the complete coding region of the protein noggin. cDNA containing the complete coding region noggin, reamplification in PCR using primers 5'-ATTACCGGTGGGAGAACCTTGTTCTTCATT-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3' and subcloned into the vector RT. Nucleotide and amino acid sequences noggin shown in SEQ ID NO: 1 and 2.

Example 2

Impact noggin on the direction of development of cells

Vector RT containing full to yuushuu part of the cDNA noggin (vector RT-noggin), was obtained as described in example 1.

Full coding sequence noggin was obtained by PCR amplification from the cDNA sample Xenopus laevis using noggin - specific primers 5'-TATCCATGGCAAGAAATCGGGAGCA-3' and 5'-ATTCTCGAGTCTCAGCATGAGCATTTGCA-3' and cloned in the vector RT (vector RT - noggin).

Synthetic mRNA noggin and noggin was obtained with the use of the assay kit mMESSAGE MASHINE Kit (Ambion) from the vectors RT - noggin and vector RT - noggin respectively, the linearized with restriction endonuclease EcoRI (Fermentas). Effects of microinjection of mRNA noggin on the development of Xenopus laevis were compared with previously described effects of injection of mRNA noggin (Smith and Harland, Cell 1992, v.70, pp.829-840; Lamb et al., Science 1993, v.262, pp.713-718; Smith et al. Nature 1993, v.361, pp.547-549). In the course of these experiments, mRNA noggin and noggin were injected with in the following blastomeres using microinjector Eppendorf.

Ventral injection of 40 PG of mRNA noggin in early embryos induced secondary axis of the body (Fig. 1A, black arrow - primary axis; the gray arrow to the secondary axis, the effect was observed in 68 of 85 subjected to microinjection embryos), whereas a similar injection of mRNA noggin (40 pag) has led to the development of mushroom-shaped embryos (Fig. 1B, the effect was observed in 68 of 75 embryos). Thus, unlike noggin (Dale and Slack, Development 1987, v.100, pp.279-295, Cell 1992, v.70, pp.829-840; Smith et al., Nature 1993, v.361, pp.547-549), noggin, not the motrya on its alleged ability to bind BMP, not induced secondary axis of the body when injected its mRNA in both ventral blastomere of 8-cell embryos. Instead, there were abnormal mushroom embryos.

In situ hybridization on total drug embryos by injection of mRNA noggin with probes to mRNA neural (NCAM, Xanf-1), epidermal (gene keratin), muscle (gene α-actin) genetic markers and genetic markers of late mesoderm (brachyury) revealed a giant neralization the ectoderm and reduction in muscle and epidermal differentiation (Fig. 1B-G). All together these results indicate that noggin can paralizovati the embryonic ectoderm, but inhibits differentiation of dorsal mesoderm and, thus, may prevent dorsalize action of endogenous noggin.

The authors also used the explants derived from the ventral marginal zone (VMZ) embryos at early gastrula, to analyze the effects noggin on the differentiation of the mesoderm. Microinjection of mRNA noggin causes severe elongation data of explantation, transforming the nature of their ventral mesoderm in muscle mesoderm (dorsalization) (Dale and Slack, Development 1987, v.100, pp.279-295, Cell 1992, v.70, pp.829-840; Smith et al., Nature 1993, v.361, pp.547-549; Fig. 1Z). In contrast, like VMZ explants without injections, expressing noggin or noggin, and noggin the explants remain rounded the mi (Fig. 1I).

For independent testing impacts noggin on the differentiation of ectodermal cells, the authors used reverse transcription-PCR (RT-PCR) and compared the expression of different genetic markers in explants naive ectoderm (animal beanies - AC), extracted from embryos at early gastrula, by microinjection introduced mRNA noggin or noggin (Fig. 1K, L). The authors also used the explants derived from the ventral marginal zone (VMZ) embryos at early gastrula, for the analysis of impacts noggin on the differentiation of the mesoderm (Fig. 1K, L).

The explants speakers were removed from embryos subjected to injection, using micronora and glass rods, as previously described in the Zaraisky et al. Developmental Biology 1992, v.152, pp.373-382. All the explants were incubated overnight in a solution of 0.5×MMR. Ten explants of each type were isolated total RNA and performed RT-PCR, as described in the Zaraisky et al. Developmental Biology 1992, v.152, pp.373-382. Used the following primers: gene α-actin: 5'-GCTGACAGAATGCAGAAG and 5'-TTGCTTGGAGGAGTGTGT; brachyury: 5'-GCTGGAAGTATGTGAATGGAG and 5'-TTAAGTGCTGTAATCTCTTCA; Cerberus: 5'-GCTTTGGTAAATGCATCTCTCTCC and 5'-GGTGACCAGTAAATCATACCTGCT; gene keratin HK: 5'-CTGAATAACATGAGAGCTG and 5'-TGGTTCTAGTTGTGGATGT; NCAM: 5'-CCTGCTTATGTGTATCGC and 5'-TTCACAGTACTGGGCTGTGCTT; Xanf-1: described in Groppe et al., 2002.

RT-PCR on the basis of total RNA from explants of speakers and VMZ embryos subjected to injection of mRNA noggin or n is ggin, was carried out with primers for markers neuroectoderm (NCAM, Xanf-1), epidermis (keratin), muscle (α-actin), late mesoderm (brachyury) and endomesoderm (Cerberus) and Ef-1-α as a control (Fig. 1L). It was shown that noggin and noggin activate the expression of neural markers (NCAM, Xanf-1) and inhibit epidermal marker (keratin), whereas only noggin activates expression of muscle marker (α-actin) in VMZ explants. Thus, in this analysis noggin showed strong narlikuyu activity, such activity noggin (Smith and Harland, Cell 1992, v.70, pp.829-840; Lamb et al., Science 1993, v.262, pp.713-718)inducyruya the expression of markers of the front part of the nervous system, but the inhibition of the epidermal marker. The ability noggin to paralizovati the ectoderm, coupled with its ability to suppress dorsalis activity noggin looks very unusual and means that noggin, in addition to BMP, can bind some other factors required for differentiation of muscle.

Example 3

Suppression of differentiation of embryonic mesoderm using noggin

Effect of microinjection of mRNA noggin on the differentiation of embryonic mesoderm was assessed by analyzing the expression of a universal marker of the early stages of development, the mesoderm gene brachyury - in early gastrula Xenopus laevis. In the course of these experiments, mRNA noggin or noggin obtained is as described in example 2, were injected with the Equatorial region of one of ventral blastomeres at the stage 8 blastomeres in the amount of 40 PG with the use of microinjector Eppendorf.

The results of the experiment shown in Fig. 2. As can be seen from Fig. 2A and A', microinjection noggin mRNA cause inhibition of gene expression of brachyury in the field of micro-injection, indicating that the suppression in this place differentiation of embryonic mesoderm. At the same time, similar microinjection of mRNA noggin not cause inhibition of the expression of brachyury and, accordingly, suppression of the development of the mesoderm (figb and B').

The results of these experiments clearly show that in contrast to noggin noggin has a unique ability to suppress the differentiation of embryonic mesoderm.

Example 4

Inhibition of BMP signalling cascade using noggin

The ability noggin to inhibit BMP signaling cascade was assessed by the ability noggin to suppress the expression of the genetic targets of this cascade - homeobox gene Vent2 - in explants of embryonic ectoderm germ (AC explants), microinjection mixture mRNA noggin and BMP2 mRNA, VMR or VMR. Given the literary evidence that different BMP able to be more active, forming heterodimer, in a special series of experiments mRNA noggin mixed for m is chronycle with mRNA of all the above BMP at the same time. As a control, similar experiments were performed with mRNA and noggin.

Gene expression Vent2 was analyzed using RT-PCR the basis of the total RNA from the AC explants as described in Example 2. Used the following Vent2-specific primers: 5'-ACTGAACACAAGGACTAATACA and 5'-AGAGGCCAGAGACTGCCCAA.

It was found that noggin able to suppress the activation of expression of Vent2 induced by any of these BMP, as well as mixtures thereof. When this inhibition Vent2 was observed even if the concentration of microinjections BMP mRNA was higher than that of noggin 30 times. In contrast, inhibition of BMP cascade noggin was observed only if the concentration of the mRNA of BMP did not exceed the concentration of mRNA noggin. These data show that noggin is much more effective inhibitor of BMP cascade than noggin.

For direct studies of the ability of the protein noggin to bind the molecules of the BMP in the germ X.laevis were expressed active forms noggin and VMR comprising the expression vector pCS2-3Myc-noggin2 and pCS2-3Flag-BMP4, respectively.

To obtain pCS2-3Myc-noggin2 vector nucleotide sequence encoding three amino acid sequence of the epitope of the protein of the ICC (EQKLISEEDLEQKLISEEDLEQKLISEEDL)was inserted by PCR in cDNA noggin directly at the 3' end of the sequence that encodes a signal peptide noggin. For this purpose, the first is Tadei cloning were obtained respectively 5' and 3' overlapping part of the cDNA noggin in PCR with primers 5'-AATTGGATCCGCCACCATGAAGAGGATAAATCTGC-3' and 5'-GAGGTCTTCCTCCGATATCAGCTTCTGTTCCAGATCCTCTTCAGAGATGAGTTTCTGCTCATAAGGCTGACAGCACCCCTGA-3', 5'-GAACAGAAGCTGATATCGGAGGAAGACCTC GAGCAGAAACTCATCTCTGAAGAGGATCTGCTCAGGCTTAGACCCTCT-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3', respectively. In the second stage, these cDNA fragments were purified from not including primers are mixed with each other, are denatured by heating, annealed and subjected to a second round of PCR with end primers 5'-AATTGGATCCGCCACCATGAAGAGGATAAATCTGC-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3'. Received a full-sized cDNA noggin containing a sequence encoding three amino acid sequence of the ICC, was cloned into the vector pCS2 on restrictum sigam NcoI(blunt)/AgeI(blunt) and XhoI/XhoI. To obtain pCS2-3Flag-BMP4 vector nucleotide sequence encoding three amino acid sequence Flag (DYKDDDDKDYKDDDDKDYKDDDDK)was inserted by PCR in cDNA VMR directly at the 3' end of the sequence that encodes proregion protein VMR Xenopus laevis. At the first stage of cloning were obtained from 5' and 3' overlapping part of the cDNA VMR in PCR with primers 5'-AATTGGATCCGCCACCATGATTCCTGGTAACCGAATG-3' and 5'-TTTGTCATCATCGTCTTTGTAGTCCTTATCGTCGTCATCCTTGTAATCCTGTTTTGGACT TCTTTTTGAC-3', 5'-GACTACAAAGACGATGATGACAAAGATTACAAGGATGACGACGATA AGCAGAGACCCCGTAAAAAAAAC-3' and 5'-AATCTCGAGTCAACGGCACCCACACCCTTCCA-3', respectively. In the second stage, these cDNA fragments were purified from not including primers are mixed with each other, are denatured by heating, annealed and subjected to a second round of PCR with end primers 5'-AATTGGATCCGCCACCATGATTCCTGGTAACCGAATG-3' and 5'-AATCTCGAGTCAACGGCACCCACACCCTTCCA-3'. Received fully Asmara cDNA VMR, containing a sequence encoding three amino acid sequence for the Flag epitope was cloned into the vector pCS2 on restricted sites NcoI(blunt)/AgeI(blunt) and XhoI/XhoI.

600 PG of synthetic mRNA 3Myc-noggin2 and 600 pg of synthetic mRNA 3Flag-BMP4 were microinjection in developing embryos of X. laevis at stage 2 blastomeres. Further, these embryos were incubated in a solution of 0.1 MMR to early gastrula.

The allocation of the expressed proteins was carried out by lizirovania embryos at early gastrula according to the method described in Tanegashima et al., Int.J.Dev.Biol (2004) 48:275-283.

After extraction was conducted absorbance expressed protein 3Flag-BMP4 on the resin Flag-Agarose (Sigma) according to the manufacturer's Protocol. After washing the resin in accordance with the Protocol of the manufacturer of the presence of this resin bound peroxidase protein 3Myc-noggin2 was analyzed by the method of protein blotting using ICC-specific monoclonal antibodies (Sigma).

This experiment revealed the ability of protein molecules noggin to bind protein molecules VMR (Fig. 2ZH).

To study the ability of the protein noggin to inhibit cell embryos BMP signaling pathway induced BMP, reviewed the effect noggin on phosphorylation of intracellular transmitter of this signaling pathway protein Smadl. For this purpose, embryos Xenopus of injecor the Wali at the stage of 2-4 cells or mRNA VMR (100 pg/embryo), or a mixture of mRNA VMR (10 PG/embryo) and noggin (1 PG/embryo). Analysis of the phosphorylation Smadl in injected embryos was performed at the stage of beginning of gastrulation (stage 10) the method of Western blot using commercial monoclonal antibodies to Phospho-Smadl (Cell Signalling Technology). In the result, it was shown that noggin able to block the increase in the concentration of Phospho-Smadl caused VMR (Fig. 2, C).

Example 5

Inhibition of signaling cascade activin/nodal using noggin

The ability noggin to inhibit signaling cascade activin/nodal was assessed by the ability noggin to suppress the expression of the genetic targets of this cascade of gene brachyury in explants of embryonic ectoderm germ (AC explants), microinjection mixture mRNA noggin and mRNA Xnr1, Xnr2, or Xnr4 (homologues of the gene nodal mammals). As a control, similar experiments were performed with mRNA and noggin.

Gene expression of brachyury was analyzed using RT-PCR on total RNA from AC explants as described in Example 2.

It was found that noggin able to suppress the activation of brachyury expression induced by any of these Xnr. Thus inhibition of brachyury was observed only in the case if the concentration microinjections mRNA Xnr did not exceed that of noggin. In contrast noggin not able to inhibit the activation of brachyury gene in the Academy of Sciences of the logical tests. These data demonstrate that in contrast to noggin noggin able to inhibit not only the BMP signaling cascade, and cascade activated by members of the large superfamily of TGF-β factors activin/nodal.

To study the ability of the protein noggin to bind protein molecules activin in embryos X.laevis were expressed active forms noggin and activin-B within the expression vector pCS2-3Myc-noggin2 and pCS2-3Flag-activin-B, respectively.

Getting pCS2-3Myc-noggin2 vector was carried out as described in Example 4.

To obtain pSP64T-3Flag-activin-B vector nucleotide sequence encoding three amino acid sequence Flag (DYKDDDDKDYKDDDDKDYKDDDDK)was inserted by PCR in cDNA activin-B directly behind the sequence that encodes proregion protein activin-B Xenopus laevis. At the first stage of cloning were obtained from 5' and 3' overlapping part of the cDNA activin-B PCR with primers 5'-AATTGGATCCGCCACCATGGCTCTCCTGTTACTGCCTCTG-3' and 5'-TTTGTCATCATCGTCTTTGTAGTCCTTATCGTCGTCATCCTTGTAATCCTCGAGGCCTCTCTTACGGA-3', 5'-GACTACAAAGACGATGATGACAAAGATTACAAGGATGACGACGATAAG TGCGATGGACACACAAATT-3' and 5'-AATGAATTCATGCACAGCCGCACTCGTCCA-3', respectively. In the second stage, these cDNA fragments were purified from not including primers are mixed with each other, are denatured by heating, annealed and subjected to a second round of PCR with end primers 5'-AATTGGATCCGCCACCATGGCTCTCCTGTTACTGCCTCTG-3' and 5'-AATGAATTCATGCACAGCCGCACTCGTCCA-3'. Received a full-sized cDNA activin-B, containing the selected, encoding three amino acid sequence for the Flag epitope was cloned in the vector pSP64T on restricted sites HindIII(blunt)/Agel(blunt) and EcoRI/EcoRI.

Analysis of the ability of the expressed protein 3Myc-noggin2 to bind protein molecules 3Flag-activin-B was performed using specific antibodies according to the method described in Example 4.

This experiment revealed the ability of protein molecules noggin to bind protein molecules activin-B (Fig. 2 W).

To study the ability of the protein noggin to inhibit cell embryos signaling pathway activin/nodal, activin-induced, it was analyzed the influence noggin on phosphorylation of intracellular transmitter of this signaling pathway protein Smad2. To do this, Xenopus embryos were injected with stage 2-4 cells or mRNA activinB (100 pg/embryo), or a mixture of mRNA activinB (10 pg/embryo) and Noggin2 (1 ng/embryo). Analysis of the phosphorylation of Smad2 in injected embryos was performed at the stage of beginning of gastrulation (stage 10) the method of Western blot using commercial monoclonal antibodies to Phospho-Smad2 (Cell signaling Technology). In the result, it was shown that noggin able to block the increase in the concentration of Phospho-Smad2 caused activinB (Fig. 2, C).

Example 6

Simultaneous inhibition of signaling cascades BMP and activin/nodal and induction of head structures using noggin

As is known, the differential is Iruka structures the principal axis of the vertebrate body is inhibited on the ventral side of the embryo in the permanent activation of two major TGF-β-cascades: BMP and activin/nodal. This selective inhibition of BMP cascade leads to "default" to the development of structures typical trunk and Zadneprovsky part of the axis of the body, in particular to the development of the spinal cord and muscles. At the same time, the simultaneous inhibition of both BMP and activin/nodal cascades induce prednisolone structures, including the eye and forebrain.

In normal development the suppression of BMP cascade on the dorsal side of the embryo is a specific protein factors, sekretiruemyi cells limanowskiego organizer and able to bind BMP. The most famous of them is noggin. Microinjection of mRNA noggin in ventral vegetal blastomeres of Xenopus embryo can cause the development of additional body structures on the ventral side of the body of the embryo. This second axis of the body, induced by exogenous noggin never contain prednisolone structures whose development requires the simultaneous inhibition of both BMP and activin/nodal cascade. In normal development, inhibition of activin/nodal cascade, and is also closely associated with positive feedback Wnt-signalling cascade is other factors, sekretiruemyi cells warhead limanowskiego organizer. The most famous of them are Dikkopf and Cerberus. The latter protein is capable of binding the th three factors: BMP, nodal and Wnt. As a result, in the Rostral part of the embryo restriction on activation prednisolone differentiation and development prednisolone structures.

The ability noggin to inhibit both the BMP cascade and cascade activin/nodal, indicates the potential ability of this factor to induce prednisolone patterns. However, in the experiments described in Example 2, a similar effect could be masked strong natalizumab action noggin caused by relatively high concentrations microinjections mRNA.

In this regard, we studied the ability of low concentrations of noggin to induce the development of additional prednisolone structures in whole embryos. In this series of experiments synthetic mRNA noggin, obtained as described in Example 2, was micronational in one of ventral vegetative blastomeres of Xenopus laevis embryos at stage 8-16 blastomeres in the amount of 2-5 PG. As a result, 25% of the embryos were observed development of additional prednisolone Department. As was shown using the method of in situ hybridization with specific probes to mRNA prednisolone markers BF-1 and Pax-6, such additional head structure consisted of a finite brain and eyes (Figure 2, b and b'; D and D'). Similar patterns were absent in additional body axes, inducir the bathrooms by microinjection of mRNA noggin (Fig. 2, G and G'; E and E'). These data demonstrate a qualitative difference between the effects noggin from the effects noggin associated with the ability noggin as to inhibit BMP and activin/nodal signaling cascade.

Example 7

The preparation of recombinant protein noggin

To obtain active glycosilated noggin carried out the expression noggin in culture of epithelial cells of the green monkey CV-1 comprising expressing vector pcDNA3-6His-noggin2. To obtain pcDNA3-6His-noggin2 vector, the nucleotide sequence encoding 6 amino acid residues histidine, was built by PCR in cDNA noggin directly behind sequence that encodes a signal peptide noggin. At the first stage of cloning were obtained respectively 5' and 3' overlapping part of the cDNA noggin in PCR with primers 5'-ATTACCGGTGGGAGAACCTTGTTCTTCATT-3' and 5'-GTGATGGTGATGGTGATGCCCGGGATAAGGCTGACAGCACCCCT-3'and 5'-CATCACCATCACCATCACGGGCCCTATCTCAGGCTTAGACCCTC-3 ' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3'. In the second stage, these cDNA fragments were purified from not including primers are mixed with each other, are denatured by heating, annealed and subjected to a second round of PCR with primers 5'-ATTACCGGTGGGAGAACCTTGTTCTTCATT-3' and 5'-ATTCTCGAGTTAGCATGAACACTTACACTCTG-3'. Received a full-sized cDNA noggin containing a sequence encoding a 6 histidine, was cloned into the vector pcDNA3 on restrictum sigam NcoI (blunt) and XhoI.

Epithelial cells is Elena monkeys (CV-1) were cultured in DMEM medium (Sigma) with 10% serum (Biolot), 100 IU/ml penicillin and 100 mg/ml streptomycin at 37°C and 1 ATM. To obtain a permanent cell line producing 6His-noggin2, these cells were transliterowany pcDNA3-6His-noggin2 vector. Further selection was carried out in a medium containing 1 μg/ml of geneticin (Gibco BRL). The secretory recombinant 6His-Noggin2 were obtained from culture medium using affinity chromatography on Ni-NTA agarose (Qiagen). The protein yield was estimated as 50 µg/million cells per day. The activity of the protein was confirmed by its ability to activate neurogenesis in explants of embryonic ectoderm.

Example 8

Obtaining polyclonal antibodies against noggin cDNA containing the complete coding region noggin, reamplification as described in example 1, was subcloned into the vector pQE30 and used to transform Escherichia coli. Recombinant protein containing six his-tag residue was purified using affinity chromatography on Talon Resin (Clontech Laboratories, Inc.) under denaturing conditions, and used to immunize rabbits using standard technology. Polyclonal serum was tested against recombinant protein using the methods of ELISA and Western blot.

Sposobamiraboty activin signaling cascade by binding noggin with protein activin, introducing noggin in an organism, tissue or cell in an amount effective for inhibiting or reducing the activity of activin.



 

Same patents:

FIELD: chemistry, biochemistry.

SUBSTANCE: invention refers to genetic engineering specifically to production of muteins of placental growth factor 1st type (PLGF-1), and can be used in medicine. Monomeric human mutein PLGF-1 includes substitution or removal in polypeptide sequence of false protein of one cysteine rest (Cys) residue in position 142 of polypeptide sequence of precursor protein thus preventing multimerisation of this monomeric form.

EFFECT: reception chemically stable muteins PLGF-1 and for diagnostics and treatment of oncological and not oncological pathologies.

44 cl, 7 dwg, 2 tbl, 8 ex

FIELD: medicine; pharmacology.

SUBSTANCE: allocated human monoclonal antibodies which specifically bind a receptor of the epidermal growth factor (EGFR), and also corresponding compositions on the basis of antibodies and a biospecific molecule are described. Human antibodies can be received with use of the transgenic mouse capable to formation of set of isotypes of human monoclonal antibodies by recombination V-D-J and switching of isotypes. The pharmaceutical compositions containing human antibodies for treatment or prevention of diseases, mediated by expression EGFR, the transgenic animals distinct from a human, the specified expressing antibodies, hybridomes and transfectomes which produce human antibodies are also presented. Ways of therapy and diagnostics of the diseases mediated by expression EGFR, with use of human antibodies or their antigen-binding of fragments, and also methods of growth suppression of the cells expressing EGFR, and an induction of cytolysis of the specified cells are described.

EFFECT: invention allows obtaining therapeutic and diagnostic preparations of antibodies with improved properties.

53 cl, 22 dwg, 4 tbl, 11 ex

FIELD: biochemistry.

SUBSTANCE: invention refers to antibodies that link with CTGF. Antibodies, in particular, are directed to the areas of CTFG participating in different types of biological activity related to fibrosis. The invention also refers to the method of antibodies application in pharmaceutical compositions for the treatment of CTGF-related diseases including localised and systemic fibrotic diseases such as diseases of lungs, liver, heart, skin and kidneys, for neutralisation of biological activity of CTGF and method of treatment and prophylaxis of CTGF-related diseases. The invention covers polynucleotide sequence and its variants coding the specified antibody as well as the host cell and cell line № PTA-6006 (ATCC) producing the specified antibody.

EFFECT: use of the invention provides new specific means - antibodies which effectively neutralise certain types of CTGF activity in pathology and provide specificity and pharmacokinetic profile suitable for a therapeutic agent.

82 cl, 33 dwg, 4 tbl, 12 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention proposes hybridomas producing monoclonal antibodies showing specificity to human epiregulin. Invention discloses monoclonal antibody recognizing specifically human epiregulin with the sensitivity limit 10 pg/ml. Also, invention describes methods for specific detection of human epiregulin in a sample in vitro and a method for detection of cells expressing human epiregulin in extracellular fluid in vitro by using monoclonal antibody to human epiregulin. Invention provides a simple and highly sensitive method for detection of human epiregulin that can be used in diagnosis of human epiregulin-expressing tumors.

EFFECT: valuable biological and medicinal properties of antibody and hybridoma.

8 cl, 7 dwg, 8 ex

The invention relates to the field of medicine and relates to a composition for inhibition of angiogenesis, monoclonal antibodies, polypeptide and method of inhibiting tumor growth

family" target="_blank">

The invention relates to the field of molecular biology and concerns a new factor in the growth/differentiation of ТGЕ-collection and coding of its DNA sequences

The invention relates to biotechnology, in particular the production of hybridomas

The invention relates to biotechnology and can be used to produce human erythropoietin

The invention relates to synthetic peptide antagonists of the binding of transforming growth factor TGF1 with its receptors in the body with a sequence containing from 2 to 15 amino acids that are identical or similar to amino acids natural transforming growth factor TGF1 and/or its receptors

family" target="_blank">

The invention relates to the field of molecular biology and concerns a new factor in the growth/differentiation of ТGЕ-collection and coding of its DNA sequences

FIELD: medicine.

SUBSTANCE: invention refers to medicine and concerns angiogenesis-preventing immunotherapy. Invention substance includes immunogenic compositions for treatment of disorders associated with angiogenesis intensification, containing oligonucleotides, coding polypeptides VEGFR2, introduced as a part of plasmid or viral vectors, as well as polypeptides VEGFR2, oligonucleotides, coding autologous VEGF with damaged function of receptor activation, polypeptides VEGF and their combinations. Immunogenic compositions can be used for treatment of malignant neoplasms and metastasises, at benign neoplasm and chronic inflammatory and autoimmune diseases. Advantage of invention lies in humoral and cellular immunity induction by means of specified compositions.

EFFECT: development of effective method angiogenesis preventive immunotherapy.

19 cl, 11 ex, 7 tbl

FIELD: medicine; pharmacology.

SUBSTANCE: releasing peptides of growth hormone are described with formula (I): R112345-R2, where:А1 designates Aib, Apc or Inp; А2 designates D-Bal, D-Bip, D-Bpa, D-Dip, D-1Nal, D-2Nal, D-Ser(Bzl) or D-Тrp; А3 designates D-Bal, D-Bip, D-Bpa, D-Dip, D-1Nal, D-2Nal, D-2Ser(Bzl) or D-Trp; А4 designates 2Fua, Orn, 2Pal, 3Pal, 4Pal, Pff, Phe, Pim, Taz, 2Thi, 3Thi, Thr(Bzl); А5 designates Apc, Dab, Dap, Lys, Orn or deleted; R1 designates hydrogen; and R2 designates NH2; and their pharmaceutically acceptable salts.

EFFECT: pharmaceutical compositions and the methods of their application are presented.

25 cl, 1 tbl, 2 ex

FIELD: biotechnology, immunology.

SUBSTANCE: invention reports about preparing and characterizing two forms of Nogo protein bound with the natural myelin with respect to the presence of immunogenic properties in their. These two forms correspond to natural products of alternative splicing, their fragments and derivatives, in particular, derivatives comprising deletions in amino acid residues, and chimeric protein also and comprising novel immunogenic polypeptides and their fragments. Invention can be used in medicine for diagnostic and curative aims.

EFFECT: valuable medicinal properties of protein.

18 cl, 79 dwg, 3 tbl, 8 ex

FIELD: biotechnology, gene engineering, pharmaceutical industry, medicine.

SUBSTANCE: method for production of recombinant placental growth factor (PLGF) includes culturing of modified prokaryotic cells containing inducible expression system of PLGF to produce OD600 of 14-50, followed by expression inducing, extraction, purification and solubilizing of inclusion bodies; enriching of obtained mixture with dimer a multimer form of expressed protein by anion exchange chromatography and isolation of PLGF preferably in dimmer form by reversed-phase chromatography.

EFFECT: method for PLGF production with high specific activity and high yield.

27 cl, 5 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: agents are used modulating stem cells proliferation when treating people and animals and accelerating recovery process after peripheral blood chemotherapy.

EFFECT: enhanced effectiveness of treatment.

79 cl, 28 dwg, 44 tbl

FIELD: biotechnology, peptides.

SUBSTANCE: invention relates to a method for preparing antibodies raised to human leukocyte differentiation factor (HLDF) or to HLDF fragment (31-38) representing peptide of the following structure: Arg-Arg-Trp-His-Arg-Leu-Glu-Lys possessing with antigenic and nucleic acids-hydrolyzing properties, and for diagnostic aims also. Antibodies are prepared from rabbit plasma blood immunized with three injections of antigens wherein synthetic HLDF factor or conjugate is used as antigens. Diagnosis of anaplastic state of human cells is carried out by using solutions of antibodies to HLDF factor or HLDF fragment (31-38) in the concentration 0.0013 mg/ml as biological markers. Invention provides carrying out the differential diagnosis of tumors and normal organs and effective detecting initial stages in cell differentiation disturbances.

EFFECT: improved preparing method of antibody, improved method for diagnosis.

6 cl, 21 dwg, 1 tbl

FIELD: biotechnology, veterinary science.

SUBSTANCE: invention proposes nucleic acid molecule GDF-9B of wild and mutated types, polypeptide encoding by these nucleic acids, vector, construction, ligand and methods for using such nucleic acids and polypeptides. Proposed group o invention provides carrying out the modulation of the ovary follicle growth via activity of homodimers of GDF-9B and heterodimers of GDF-9B/GDF-9 both in vivo and in vitro. Invention can be used in animal husbandry for aim of active and passive immunization against these polypeptides for the follicle growth change.

EFFECT: valuable properties of factors.

35 cl, 9 dwg, 4 tbl, 4 ex

FIELD: biotechnology, in particular epithelial cell growth factors useful in production of new keratinocyte growth factor (KGF).

SUBSTANCE: KGF protein is obtained by cultivation of recombinant host cell, transformed with vector containing DNA which encodes amini acid sequence of KGF protein. Obtained KGF protein in pharmaceutical composition is used for forcing of epithelial cell proliferation. Method of present invention makes it possible to produce KGF protein with specific mitogenic activity of 3.4 x 104 U/mg of protein in relation to keratinocyte cells.

EFFECT: new keratinocyte growth factor.

52 cl, 14 dwg, 3 tbl

FIELD: biotechnology, molecular biology, medicine, genetic engineering, pharmacy.

SUBSTANCE: the hemopoietic protein comprises the amino acid sequence of the formula: R1-L1-R1, R2-L1-R1, R1-R2 or R2-R1 wherein R1 represents the modified ligand flt-3; R2 represents the modified human IL-3, the modified or unmodified colony-stimulating factor. Modification of R1 is carried out by addition of N-end with C-end directly or through linker (L2) that is able to join N-end with C-end to form new C- and N-ends. The modified human IL-3 is prepared by replacing amino acids at positions 17-123. The human G-CSF is modified by exchange of amino acids. The hemopoietic protein is prepared by culturing cells transformed with vector comprising DNA that encodes the hemopoietic protein. The hemopoietic protein stimulates producing hemopoietic cells and this protein is used as a component of pharmaceutical composition used in treatment of humans suffering with tumor, infectious or autoimmune disease. Invention provides preparing multifunctional hemopoietic proteins eliciting the enhanced activity with respect to stimulation of hemopoietic cells and eliciting the improved physical indices. Invention can be used for preparing chimeric multifunctional hemopoietic proteins.

EFFECT: improved preparing and producing method, valuable medicinal properties of protein.

22 cl, 19 dwg, 18 tbl, 117 ex

Up!