Animal cells (C12N5/16)

ethod of determining safety of probiotic microorganisms using cell test systems // 2604804
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology. Method of determining safety of probiotic microorganisms is disclosed, in which test systems are cell cultures of mammals and human. Method involves three stages: preparation of analyzed object, preparation of test system and determination of safety of object for test system. Toxicity and toxigenicity of probiotic microorganisms are evaluated on basis of cell culture vitality determination using Goryaev's chamber.EFFECT: invention provides higher accuracy and reliability of results of determination of safety of probiotic microorganisms for humans.1 cl, 4 tbl, 1 ex

ethod of determining safety of food ingredients with help of cell test systems // 2604802
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, namely to hygienic safety facilities of food purposes. Method of determining safety of food ingredients is disclosed, in which test systems are cell cultures of mammals and human. Method involves three stages: preparation of analyzed object, preparation of test system and determination of safety of object for test system. Safety of food ingredients is estimated on basis of determination of cell culture viability using Goryaev's chamber and cytopathic activity of analyzed objects.EFFECT: invention provides higher accuracy and reliability of results of determination of safety of food ingredients for humans.1 cl, 4 tbl, 2 ex

Strain of hybrid animal cells mus musculus 1g7 - producer of monoclonal antibodies specific for botulinum toxin of type b // 2571208
FIELD: biotechnology.SUBSTANCE: strain of hybrid cells of animals Mus musculus 1G7 - producer of monoclonal antibodies to the botulinum toxin of type B. The strain is deposited in the state collection of pathogenic microorganisms and cell cultures of the Federal State Institution of Science of State Research Centre of Applied Microbiology and Biotechnology (FSIS SRC AMB), the collection number is H-46.EFFECT: invention enables to obtain highly specific monoclonal antibodies to botulinum neurotoxin of type B suitable for construction on their basis of test-systems for detection of the causative agent of botulism.6 dwg, 2 tbl, 8 ex

Strain of hybrid cells of animals mus musculus 3f11 - producer of monoclonal antibodies specific to botulinus toxin type b // 2566553
FIELD: bioengineering.SUBSTANCE: strain of hybrid cells of animals Mus. musculus 3F11 - producer of monoclonal antibodies specific to botulinus toxin type B is suggested. The strain is deposited to state collection of pathogens and cell cultures of Federal Budget Institution of Science of State Scientific Centre of Applied Microbiology and Bioengineering (FBIS SSC AMB),collection No. - H-45.EFFECT: invention ensures production of the highly specific monoclonal antibodies to botulinic neurotoxin type B, suitable for construction of their base of the test-systems to identify botulinus.6 dwg, 2 tbl, 8 ex

Culture cell strain cho-il7/13 producing human interleukin-7 // 2562169
FIELD: medicine.SUBSTANCE: invention refers to biotechnology and concerns the cell strain CHO-IL7/13. The characterised strain is produced by transfection of the cells CHOdhfr by pIPvES-DHFR/IL7 plasmid containing human interleukin-7 gene. pIPvES-DHFR/IL7 plasmid has been synthesised by primer amplification of human interleukin-7 complementary DNA: ecoIL CCTGAATTCCACCATGTTCCATGTTTCTTTTAG containing EcoRI restriction site and Kozak sequence, and bamIL CCAGGATCCTCAGTGTTCTTTAGTGCCCATC containing BamHI restriction site that is followed by cloning according to the restriction site data into pIRES-DHFR vector.EFFECT: presented strain has a higher producing ability of human recombinant interleukin-7 and can be used for treating the number of pathological conditions associated with the low content of B- and T-lymphocytes.4 dwg, 3 ex

Antibodies or their fragments, aimed against staphylococcus aureus epitope // 2560415
FIELD: medicine.SUBSTANCE: invention relates to field of biochemistry, in particular to antibody or its functional fragment, aimed against Staphylococcus aureus epitope, as well as to their application for Staphylococcus aureus detection. Disclosed is cell line of hybridoma, which produces said antibody, where cell line of hybridoma is cell line, deposited in DSMZ under accession number DSM ACC2987. Invention also relates to method of treatment or prevention, which contains introduction of said antibody or its functional fragment to human or animal, where treatment is treatment of infection in human or animal, where infection is caused by Staphylococcus aureus, and where prevention is prevention of such disease, caused by Staphylococcus aureus.EFFECT: invention makes it possible to effectively treat human infection, caused by Staphylococcus aureus.20 cl, 7 dwg, 1 tbl

External cow lipopolysaccharide epitope h. pylori // 2558257
FIELD: chemistry.SUBSTANCE: present invention relates to biotechnology and provides a α1,6-glucan-containing compound of Helicobacter pylori. The present invention also discloses a conjugate for inducing immune response against H.pylori, which contains said compound conjugated with a carrier protein. The present invention also discloses an immunogenic composition, use of said composition and a method of inducing immune response against H.pylori using said composition. The present invention also discloses immune serum for neutralising H.pylori in mammals, which is obtained by immunising said mammal with an immunogenic composition containing said immunogenic composition. The present invention discloses an antibody which recognises said α1,6-glucan-containing compound of H.pylori, use of said antibody and a method of inducing complement-mediated bacteriolysis of H.pylori strains which express α1,6-glucan using said antibody.EFFECT: invention improves the effectiveness of immunogenic compositions against Hpylori.27 cl, 8 dwg, 21 tbl, 11 ex

Composition for amplification of transgene expression in eucariotic cells, and method for increasing generation of target protein coded with transgene // 2546249
FIELD: biotechnologies.SUBSTANCE: invention relates to compositions for intensive generation of a target protein in eucariotic cells, which includes a DNA vector with an insert of target protein gene and an agonist of cell receptors. Besides, the invention relates to methods for increasing generation of a target protein coded with a transgene in eucariotic cells by using the above compositions.EFFECT: invention allows effective increase of generation of a target protein in eucariotic cells.28 cl, 4 dwg, 7 tbl, 10 ex

ethod for producing hybrid/chimeric cells and using them // 2536978
FIELD: medicineSUBSTANCE: what is presented is a trihybrid cell for protein expression, produced by hybridizing a first cell representing a stem cell or a cell originated from a virgin progenitor, a second cell originated from a common lymphoid progenitor, and a third cell originated from a common lymphoid progenitor, wherein the above first cell is other than a myeloma cell; a method for producing it and a method for producing proteins with using the same are also presented.EFFECT: increasing protein stability produced by the above trihybrid cell and providing the more effective production of the therapeutic proteins ensure using the invention for protein expression applicable for diagnostic, preventive, therapeutic and/or scientific purposes.64 cl, 62 dwg, 9 tbl, 12 ex

ethods of obtaining cells, demonstrating phenotypic plasticity // 2536941
FIELD: chemistry.SUBSTANCE: invention relates to molecular biology and cell technologies. Claimed is a method of obtaining a cell with the specified phenotype, where the said method includes stages of hybridisation of the first stem cell or the cell, derived from an uncommitted precursor cell, the second cell, derived from the common lymphoid precursor cell, and the third cell, derived from the common lymphoid precursor cell, with obtaining a hybrid cell, which demonstrates phenotypic plasticity, and influence on the said hybrid cell of conditions, selected from the group, consisting of the thymic stromal cell, cytokine, growth factor, immunoglobulin, ligand of receptors or their combination, in such a way that the said hybrid cell becomes the said cell with the phenotype of B-cell, T-cell, myeloid cell or dedifferentiated phenotype relative to the said hybrid cell.EFFECT: due to the increase of functional stability of the hybrid cells and increase of their phenotypic plasticity and effectiveness of transdifferentiation, the invention can be used for tissue formation in medicine.37 cl, 33 dwg, 11 tbl, 7 ex

Producing poultry and other animals resistant to viral diseases // 2533804
FIELD: medicine.SUBSTANCE: invention refers to biotechnology and genetic engineering. A cell contains a construct, which comprises a sequence coding siRNA to a conserved region of a foot-and-mouth disease virus (FMDV) or avian influenza virus. What is disclosed is producing a transgenic vertebrate, other than a human from the above cells, which possess the resistance to the above viral diseases. The invention can be used in animal production and veterinary science.EFFECT: what is presented is a transgenic embryo cell of a vertebrate, other than a human.22 cl, 20 dwg, 4 tbl

Heavy chain mutant resulting in increased immunoglobulin production // 2522481
FIELD: medicine, pharmaceutics.SUBSTANCE: present invention refers to immunology and biotechnology. There are presented versions of nucleic acids each of which codes a heavy-chain amino acid sequence of immunoglobulin IgG1. The above chain contains glycine-lysine dipeptide coded by ggaaaa, ggcaaa or gggaaa codon at the C terminal of the CH3 domain. There are described: a plasmid coding a heavy chain of immunoglobulin; version cells providing immunoglobulin IgG1 expression; a method for producing immunoglobulin in mammalian cells; a method for improving immunoglobulin expression in the mammalian cells; - using the versions of a nucleic acid.EFFECT: using the invention provides preventing the by-product expression of weight 80 kDa that can find application in producing immunoglubulins.18 cl, 7 dwg, 3 tbl, 6 ex

Novel bnp (1-32) epitope and antibodies directed against said epitope // 2511033
FIELD: chemistry.SUBSTANCE: invention relates to biochemistry, particularly a polypeptide bearing a human BNP(1-32) epitope, for producing ligands that are directed against the human BNP(1-32) or human proBNP(1-108), where said polypeptide has the formula α1-R1-X1-FGRKMDR-X2-R2-α2. Disclosed is use of said polypeptide to produce ligands directed against the human BNP(1-32) or human proBNP(1-108) and for producing a hybridoma which secretes a monoclonal antibody directed against the human BNP(1-32) or human proBNP(1-108). Disclosed is a method of producing a hybridoma which secretes a monoclonal antibody directed against the human BNP(1-32) or human proBNP(1-108), as well as the obtained hybridoma. Disclosed is a ligand which is specific to an epitope with the sequence FGRKMDR, as well as use thereof to detect human BNP(1-32) or human proBNP(1-108) in a biological sample. Disclosed are methods of detecting human BNP(1-32) or a human proBNP(1-108) derivative in a biological sample, a method for in vitro diagnosis, prediction, risk stratification or subsequent observation of long-term results of cardiac and/or vascular pathology in an individual, as well as a method for in vitro diagnosis of stroke in an individual using said ligand. Disclosed is a multi-epitope calibrator designed to obtain calibration curves for analysis of BNP(1-32), proBNP(1-108), as well as a kit for detecting human BNP(1-32) or human proBNP(1-108).EFFECT: invention enables to efficiently detect cardiac and/or vascular pathologies in an individual.15 cl, 17 dwg, 12 tbl, 18 ex

Lymphotoxin alpha antibodies // 2486201
FIELD: medicine, pharmaceutics.SUBSTANCE: present invention refers to immunology. What is presented is a lymphotoxin-alpha (LTα) antibody, including chimeric and humanised versions thereof. Where are disclosed compositions containing it, using it for preparing a medication for autoimmune disorders, a method of inhibiting ex vivo lymphotoxin-alpha activated cell proliferation with using the antibody under the invention, as well as a nucleic acid, an expression vector, a host cell and a method of producing the antibody that proceeds from using them.EFFECT: present invention can find further application in a therapy of the autoimmune diseases.51 cl, 21 ex, 27 dwg, 7 tbl

Strain of hybrid animal cells mus musculus 2b8 - producer of monoclonal antibodies specific to yersinia pestis v antigen // 2478704
FIELD: chemistry.SUBSTANCE: invention relates to biotechnology and can be used to obtain monoclonal antibodies against the Yersinia pestis V antigen. The strain of hybrid animal cells Mus musculus 2B8 is obtained by immunising BALB/c mice. The mice are immunised by four-time administration of a recombinant V antigen in a dose of 100 mcg/mouse. On the third day after the last immunication, splenocytes of immune mice (1×108 cells) are hybridised with mouse myeloma cells RZ-X63 Ag/8-653 (1×107 cells). The fusion agent used is polyethylene glycol (Sigma, USA). Hybridisation is followed by selection, screening, cloning and cryopreservation of the hybridoma. The strain is deposited in the state collection of pathogenic microorganisms and cell cultures (GKPM-Obolensk) under number N-20.EFFECT: strain of hybrid cultured cells, which produces monoclonal antibodies which are specific to the Y pestis V antigen, is suitable for constructing test systems for detecting plague pathogens.8 dwg, 3 tbl, 7 ex

Strain of hybrid animal cells mus musculus 5g6 - producer of monoclonal antibodies specific to yersinia pestis v antigen // 2478703
FIELD: chemistry.SUBSTANCE: invention relates to biotechnology and can be used to obtain monoclonal antibodies against the Yersinia pestis V antigen. The strain of hybrid animal cells Mus musculus 5G6 is obtained by immunising BALB/c mice. The mice are immunised by four-time administration of a recombinant V antigen in a dose of 100 mcg/mouse. On the third day after the last immunication, splenocytes of immune mice (1×108 cells) are hybridised with mouse myeloma cells RZ-X63 Ag/8-653 (1×107 cells). The fusion agent used is polyethylene glycol (Sigma, USA). Hybridisation is followed by selection, screening, cloning and cryopreservation of the hybridoma. The strain is deposited in the state collection of pathogenic microorganisms and cell cultures (GKPM-Obolensk) under number N-19.EFFECT: strain of hybrid cultured cells, which produces monoclonal antibodies which are specific to the Y pestis V antigen, is suitable for constructing test systems for detecting plague pathogens.8 dwg, 2 tbl, 7 ex

ethod for assessing osteocyte involvement in bone matrix mineralisation // 2466408
FIELD: medicine.SUBSTANCE: osteons and intermediate lamellas are delineated and framed as members of analysis; osteocyte lacunae are numbered in each formed image; total number is presented, as well as a number of lacunae containing minerals in an amorphous phase. A percentage of the latter is described as a coefficient of osteocyte involvement in bone matrix mineralisation. If the minerals in the amorphous phase are found in less than 30% of lacunae, mineralisation activity of osteocyte is considered to be low. The presence of the amorphous minerals in 30-80% of lacunae shows moderate activity, and if more than 80% of lacunae contain the minerals in the amorphous phase, high activity is stated.EFFECT: improved assessment accuracy.1 ex, 2 dwg

Hybrid cell strain of mus musculus animals 10g4 - producer of monoclonal antibodies specific to capsular f1 antigen yersinia pestis // 2460787
FIELD: medicine.SUBSTANCE: what is presented is a hybrid cell strain of Mus musculus 10G4 deposited in the collection of microorganisms Federal State Research Institution State Research Centre for Applied Microbiology and Biotechnology, No. N-13.EFFECT: strain may be used for producing monoclonal antibodies to capsular F1 antigen Yersinia pestis and is applicable for constructing the based plague agent test systems.7 dwg, 4 tbl, 7 ex

ethods and compositions for expressing negative-sense viral rna in canine cells // 2457250
FIELD: chemistry.SUBSTANCE: invention is an isolated nucleic acid comprising a canine RNA polymerase I regulatory sequence and containing (i) at least 250 or at least 350 or at least 450 adjoining nucleotides or an entire nucleotide sequence, which is in form of SEQ ID NO:26, (ii) a nucleotide which is at least 80% identical to said nucleotide sequence (i) or includes a complementary or reverse complementary (i) or (ii) sequence. The nucleotide sequence (i) or (ii) is operably linked to cDNA which encodes influenza virus vRNA, and when produced in MDCK cells, is capable of directing expression of said influenza virus vRNA. The present invention also describes expression vectors and cells containing such nucleic acids, as well as methods of using such nucleic acids to obtain influenza viruses, including infectious influenza viruses.EFFECT: canine plasmid rescue system pol I enables to obtain recombinant influenza viruses in a canine cell culture with high titre.25 cl, 16 dwg, 7 tbl, 12 ex
us musculus cultivated hybrid cell strain producer of monoclonal antibodies specific to human recombinant erythropoietin (versions) // 2451071
FIELD: medicine.SUBSTANCE: invention describes Mus museums hybrid cultivated cell strains of Russian National Collection of Industrial Microorganisms H-117, Russian National Collection of Industrial Microorganisms H-116, Russian National Collection of Industrial Microorganisms H-115, Russian National Collection of Industrial Microorganisms H-113 and Russian National Collection of Industrial Microorganisms H-114 - producers of the monoclonal antibodies showing various specificity to human recombinant erythropoietin (EPO) and enabling distinguishing between a glycolised form of EPO and accompanying hypo- and deglycolised impurities. Estimating the strain efficacy and the produced antibody specificity is ensured by immune-enzyme assay with using a number of specificity markers: EPO recombinant protein; hypoglycolised EPO (o-glycolised) produced by natural antigen periodate oxidation; deglycolised EPO (de-EPO) produced by enzymatic treatment of recombinant EPO (PNGasa).EFFECT: hybridoma produced monoclonal antibodies with said specificity are required for recovery of glycolised forms of EPO, and the quantitative and qualitative analysis of EPO mixtures.5 cl, 2 tbl, 5 ex

Recombinant plasmid dna pap271 coding human blood coagulability factor vii polypeptide and mesocricetus auratus bhk 21 k. 13 (2h7) cell line producer of recombinant human blood coagulability factor vii // 2448160
FIELD: medicine.SUBSTANCE: there is constructed a recombinant plasmid DNA pAP271 containing a rhFVII protein gene, a MAR matrix attachment region of an avian lysozyme gene, CMV virus transcription amplifier, a promoter of translational factor of human EF-1α elongation, an internal site of translational initiation of encephalomyocarditis IRES virus, a mouse DHFR gene, a SV40 virus polyadenylation signal, a cartridge comprising all elements required for aminoglycoside-3'-phosphotransferase (APH) gene expression, a cartridge for expression in bacterial cells of β-lactamase gene, as well as unique recognition sites of the following restriction endonucleases: Agel (850 base pairs), BbvCI (1657 base pairs), BmgBI (4202 base pairs), BssHII (6672 base pairs), Eco47III (11269 base pairs), EcoRI (10929 base pairs), EcoRV (11863 base pairs), Fsel (1455 base pairs), NotI (4812 base pairs), RsrII (6790 base pairs), Sbfl (2330 base pairs), Sfil (6027 base pairs), Tthllll (6390 base pairs), Xcml (2404 base pairs).EFFECT: presented invention provides producing stably high-yield recombinant human blood coagulability factor VII.2 cl, 4 dwg, 2 ex

Fused partner cell // 2431667
FIELD: medicine.SUBSTANCE: invention describes fused partner cells making it possible to produce heterohybridomas of cells of biological species different from a mouse. Heterohybridomas are produced by fused myeloma cells produced from an animal of a first biological species with leukemia cells produced from an animal of a second biological species which have an additional S-phase in a cell cycle and exhibit a diploidisation property. The fusion partner cell SPYMEG is deposited, No. FERM BP-10761 and can be used for hybridoma production. What is described is hybridoma producing antibodies produced by fusion of fusion partner cell and a third cell with antibody-producing ability. The invention describes methods for producing a fusion partner cell, a hybridoma and an antibody-producing cell, and also methods for producing antibodies. Use of the invention provides stable and simple production of the substances with the use of hybridomas in a wide range of species of animals.EFFECT: hybridomas stably keep a phenotype throughout the whole process of cloning.20 cl, 10 dwg, 2 tbl, 10 ex
Strain of hybrid cultivated cells of animals mus musculus, producing monoclonal antibodies, specific to peptide, which possesses apoptotic activity with respect to cancer cells // 2402605
FIELD: medicine.SUBSTANCE: described is strain of hybrid cultivated cells of animals Mus. Musculus RIM9 - producer of monoclonal antibodies, specific to peptide of human milk - lactaptin and its recombinant analogues, which possess apoptotic activity with respect to human cancer cells. Invention allows to obtain monoclonal antibodies, recognising general linear antigen determinant of recombinant and natural lactaptin.EFFECT: possibility to elaborate sensitive and specific test-systems for detecting lactaptin, antibodies to it and for isolation of lactaptin from human milk by method of affinity chromatography.2 tbl, 4 ex

Non-mouse anti-m-csf-antibody (versions), preparation and use thereof // 2401277
FIELD: chemistry.SUBSTANCE: invention relates to anti-M-CSF-specific antibodies based on RX1 or originating from RX1, and which more than 785% compete with monoclonal antibodies RX1, MC1 and/or MC3 for bonding with M-CSF (macrophagal colony-stimulating factor). The non-mouse antibody is two-stranded, contains a certain amino acid sequence (given in the formula of invention and list of sequences) and retains high affinity towards M-CSF. The invention discloses an isolated nucleic acid which codes the said antibody, an expression vector, a host cell and a method of producing the anti-M-CSF-antibody using a host cell or hybridome, particularly ATCC PTA-6263 or ATCC PTA-6264 hybridome. The invention describes a pharmaceutical composition containing said antibodies, sets containing pharmaceutical compositions and methods of preventing and treating osteoporosis in a person suffering from an osteolytic disease.EFFECT: disclosed antibodies can inhibit osteoclast differentiation, which facilitates their use as highly effective preparations for treating osteolysis, cancer with metastases and osteoporosis associated with cancer metastases.131 cl, 44 dwg, 12 tbl, 16 ex

Strain of hybrid cultivated animal cells mus museums 2e4-producer of monoclonal antibodies specific to heat shock protein 70 // 2381271
FIELD: medicine.SUBSTANCE: invention refers to biotechnology. Hybridoma strain is prepared by immunisation of BALB/c mice with bovine HSP 70 within 78 days. On the third day, splenocyte hybridisation of immune mice (10 cells) with murine myeloma cells P3-X63 Ag/8-653 (107 cells) is carried out. As a fusion agent, polyethylene glycol of molecular weight 4000 (Merk, Germany) is applied. Hybridisation is followed with selection, screening, cloning and cryopreservation of hybridoma.EFFECT: invention can be used for preparing monoclonal antibodies (MCA) to heat shock protein 70 (HSP 70).4 dwg, 1 tbl, 6 ex
Strain 8c12 of permanent inter-species hybrid line of cells of mouse mus. musculus and sheep ovis aries - producent of monoclonal antibodies to glycoproteidal antigen of virus of cattle leucosis // 2377297
FIELD: veterinary.SUBSTANCE: obtained is strain 8C12 of inter-species hybrid cells of mouse Mus musculus and sheep Ovis aries - producent of monoclonal antibodies of sheep to glycoproteidal antigen of virus of cattle (C) leucosis. Strain is deposited with Special Collection of re-inoculated somatic cell cultures of agricultural and commerciall sold animals by No 72. Strain is permanent hybrid line of cells and possesses high level of production of monoclonal antibodies of sheep. Antibody titers in native culture liquid constitute 1:32-1:64 in immuno-enzymatic analysys (IEA). Monoclonal antibodies are specific to general antigen determinant of glycoproteids of C leucosis - external gp51 and transmembranous gp30. When used in IEA for detection of antibodies in blood serum and milk of C infected with leucosis virus, antibodies provide strong selective binding with solid-phase carrier and optimal space orientation of glycoproteidal antigen.EFFECT: strain 8C12 can be used in production of immuno-enzymatic test-system for diagnostics of cattle leucosis, which will allow to increase efficiency of sanitation measures, reduce terms of enhancement of adverse in terms of leucosis cattle-breeding farms and, as a result, reduce incidence of leucosis in cattle.1 tbl, 4 ex

Strain of hybrid cultured animal cells-producer of rat monoclonal antibodies to hypoglycosylated and deglycosylated isoforms of tumours associated with human muci antigen // 2342428
FIELD: chemistry; biochemistry.SUBSTANCE: present invention pertains to biochemistry, specifically to obtaining a hybrid, and can be used for obtaining a strain-producer of monoclonal antibodies to the MUCI human antigen. Using monoclonal antibody technology, a strain of hybrid cultured animal cells "ВКПМ Н-105" - producer of clinical rat monoclonal antibodies, specific for hypoglycosylated and deglycosylated isoforms of tumours associated with the human MUCI antigen can be obtained.EFFECT: possibility of identifying clinical isoforms of MUCI antigen using antibodies, produced by an obtained strain, the antibodies of which can be used determining concentration of MUCI in blood plasma of a person previously diagnosed with tumours.1 dwg, 3 ex

Glycosylated antibodies (variants) possessing enhanced antibody-dependent cellular cytotoxicity // 2321630
FIELD: medicine, peptides, biochemistry, pharmacy.SUBSTANCE: invention relates to modification of glycosylation of proteins for preparing polypeptides with improved therapeutic indices including antibodies with enhanced antibody-dependent cellular cytotoxicity. For preparing indicated polypeptides cell-host is used that is modified with nucleic acid encoding enzyme β-1,4-N-acetylglucosaminyltransferase III (GnTIII). Prepared polypeptide represents, in particular, IgG or its fragment. Invention discloses a method for preparing polypeptide and antibodies or its fragment and a fusion protein prepared by indicated method. Invention describes a pharmaceutical composition used for increasing Fc-mediated cellular cytotoxicity and comprising antibody and carrier, and its using in cancer treatment, and a method for treatment of disease associated with elevated amount or production of B cells using indicated antibody, in particular, against CD20, and representing antibody IDEC-C2B8 in the preferable variant. Invention provides preparing polypeptide and antibody possessing the enhanced Fc-mediated cellular cytotoxicity that decrease the content of B cells in a patient body.EFFECT: improved preparing method, valuable medicinal properties of polypeptide and antibodies.38 cl, 21 dwg, 4 ex

Antibodies raised against α-interferon // 2314317
FIELD: biotechnology, immunology.SUBSTANCE: invention describes a monoclonal anti-IFNα antibody that binds with the following subtypes of IFNα: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα21 and comprises three CDR-sites of heavy chain. Amino acid is given in the invention description. Invention discloses heavy chain of anti-IFNα antibody or its fragment that comprise indicated CDR-sites also. Invention describes anti-IFNα antibody that comprises at least one light chain and one heavy chain. Invention discloses variants of nucleic acids encoding indicated antibodies and variants of vectors used for expression of nucleic acids, and variants of transformed host-cells. Among expression vectors invention describes also vectors deposited at № 2881 and № 2882 carrying heavy and light chain of antibody, respectively. Invention describes a method for preparing antibody from indicated cells. Invention discloses the murine hybridoma cell line deposited in ATCC at number № РТА-2917, and antibody produced by indicated cell line. Also, invention describes variants of the antibody-base pharmaceutical composition and a method used for diagnosis of autoimmune disease. Also, invention discloses using antibodies in treatment of disease or state associated with enhanced level of IFNα in a patient. Using the invention provides inhibiting biological activity of at least seven human IFNα subtypes simultaneously, namely: IFNα1, IFNα2, IFNα4, IFNα5, IFNα8, IFNα10 and IFNα12 that can be used in diagnosis and therapy of different human diseases mediated by IFNα, such as insulin-dependent diabetes mellitus or erythematosus lupus.EFFECT: valuable biological and medicinal properties of antibodies.53 cl, 4 tbl, 10 dwg, 2 ex

Conformational anomalous forms of tau proteins and specific antibodies to them // 2299889
FIELD: immunology, biotechnology.SUBSTANCE: invention relates to antibodies showing specificity to anomalous processed form of human tau protein that differs by conformation from the normal tau protein and doesn't bind with normal tau protein. Also, invention relates to conformational distinctive tau proteins ("tauones") and diagnostic and therapeutic aspects related to Alzheimer's disease and related taupathies. Proposed antibodies are produced by hybridomas DC-11 or Dc-11/1 deposited in ECACC at numbers 00082215 and 00082216. Also, invention described truncated forms of human tau protein that are truncated by N- and/or C-end and comprise amino acid residues from amino acid 300 to amino acid 400 in the longest isoform of human tau protein (441 amino acids residues). Above mentioned truncated forms of human tau protein can be recognized specifically by antibodies described above. Also, invention describes a method for assay of truncated forms of tau protein in a patient biological sample using a set comprising a proposed antibody and suitable container. Using the proposed invention provides a suitable target for medicinal preparations with early therapeutic effect used in Alzheimer's disease and other taupathies.EFFECT: valuable medicinal properties of proteins.11 cl, 15 dwg, 10 ex

ethod for in vivo transformation of animal testicle stem cells // 2290442
FIELD: biotechnology.SUBSTANCE: claimed method includes injection of vector construct pX-RSVhGH encoding human growth hormone or pX-Ins, encoding human insulin into parenchyma of 8-9-week rabbit males. Transformation effectiveness of gene constructs is determined by immunohystochemical kit Novocastra (Sigma, USA).EFFECT: method for genetic transformation of rabbit testicle stem cells with increased effectiveness.3 dwg, 1 ex
ethod of stimulation of fibroplasts growth in culture // 2287013
FIELD: biotechnology; morphologic investigation of cultivated cells.SUBSTANCE: primary culture of fibroplasts is subject to influence of electromagnet radiation during 5 minutes continuously with pulse frequency of 73+- Hz and with pulse amplitude of 50V and higher.EFFECT: improved effectives of growth; higher density of fibroplasts in culture.1 tbl

Strain of hybrid culturing rattus norvegicus 122h9 cells which is producer of cross-reactive neutralizing monoclonal antibodies against pathogenic for human orthopoxviruses // 2281327
FIELD: biotechnology and virology.SUBSTANCE: strain of hybrid culturing Rattus norvegicus 122H9 cells is disclosed. Said strain is obtained by fusion of rat myeloma cells 210RC.Y3-Ag1.2.3 with rat spleen cells LOU, immunized with purified ectromelia virus of K-1 strain. Said strain is producer of cross-reactive neutralizing monoclonal antibodies against pathogenic for human orthopoxviruses.EFFECT: vaccines for prophylaxis and therapy of diseases associated with pathogenic for human orthopoxviruses.2 tbl, 5 ex

Antibodies against phosphorylated vasp (vasodilator-stimulated the phosphoprotein), hybridoma cells for their production and their use // 2218178
The invention relates to medicine and relates to monoclonal antibodies against VASP (vasodilator-stimulated the phosphoprotein), which bind VASP as antigen only when VASP is phosphorylated in the form hybridoma cells for their preparation and to the use of antibodies or fragments of antibodies as diagnostic and/or therapeutic agents

The method of obtaining recombinant human erythropoietin and the erythropoietin, a pharmaceutical composition // 2215748
The invention relates to biotechnology and is used for the preparation of recombinant human erythropoietin (EPO)

Hybridoma marked m, and a monoclonal antibody secreted by this hybridomas // 2183671
The invention relates to biotechnology and immunology, and can be used in immunohistochemical analysis to determine the localizationd

Strains cultivated hybrid mice - producers of monoclonal antibodies to human erythropoietin, the antibodies produced by them // 2151184
The invention relates to biotechnology, in particular the production of hybridomas

The method of purification of recombinant human erythropoietin // 2145610
The invention relates to biotechnology and can be used to produce human erythropoietin

Conjugate-based anti-jgm-antibodies (options) and the method of reducing the secretion jgm antibodies by lymphocytes (options) // 2105062
The invention relates to the field of immunology, in particular the production and use of monoclonal antibodies

Strain sno cultured chinese hamster cells producing human erythropoietin // 2089611
The invention relates to biotechnology, namely the industrial production of human erythropoietin, concerns the creation of a new strain of Chinese hamster cells producing human erythropoietin, which can be used for therapeutic and research purposes in medicine and biology
 
2550966.
Up!