Viruses, e.g. bacteriophages and compositions thereof and preparation or purification thereof (C12N7)

Attenuated strain "msc-2015 vniivvim" of african swine fever virus serotype viii for virology and molecular-genetic analysis // 2607791
FIELD: medicine.SUBSTANCE: invention relates to virology. Attenuated strain “SKA-2015 VNIIVViM” of african swine fever virus serotype VIII is disclosed. Strain is produced by intermittent passages and selection of virulent strain "Stavropol 01/08" in primary cell culture of LS and transplantable hybrid cell line A4C2/9k and it is deposited in State collection of strains of microorganisms GNU Rosselhozakademii VNIIVViM under No. 1847.EFFECT: strain "MSC-2015 VNIIVViM" can be used during virological, molecular-genetic research, studying immunogenesis of disease, development of diagnostic and vaccine preparations.1 cl, 4 tbl, 4 ex
ethods of producing viral particles with simplified surface proteins' glycosylation // 2607452
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology. Method for production of influenza virus with monoglycosylated hemagglutinin-antigen (HA-antigen) is disclosed. Method involves cultivation of influenza virus, containing hemagglutinin-antigen in specific pathogen free (SPF) chicken egg with embryo with an effective amount of mannosidase inhibitor, concentration of which is sufficient for inhibiting of α-mannosidase I in the path of N-glycosylation followed by extraction of produced influenza virus. Further contact of extracted influenza virus with endoglycosidase (EndoH) leads to production of influenza virus, having monoglycosylated influenza virus HA-antigen.EFFECT: disclosed method enables to obtain influenza virus with monoglycosylated hemagglutinin-antigen (HA-antigen) with high yield using specific pathogen free (SPF) chicken eggs with embryo, and can be used for producing monoglycosylated hemagglutinin-antigen in production of vaccines.19 cl, 4 dwg, 4 ex
Viral vectors cleaning system // 2607044
FIELD: biotechnology.SUBSTANCE: disclosed is viral vector cleaning method. Method involves introduction of exogenous gene coding receptor and representing gene interest in packing cell line, followed by cells culturing, collection of supernatant containing viral vector particles carrying receptor on its outer shell. Subsequent supernatant incubation with ligand, connected with fragment, which can be extracted from supernatant, leads to ligand binding with receptor, as a result of which obtained ligand-viral vector complex can be extracted from supernatant to produce viral vector purified particles.EFFECT: proposed cleaning method is effective and provides high level of extraction, and can be used in biotechnology for viral vectors cleaning.15 cl, 3 dwg, 4 tbl, 6 ex
ethod of determining biological activity of measles, epidemic parotitis and rubella during production of associated preparations (versions) // 2606848
FIELD: biotechnology.SUBSTANCE: invention relates to medical biotechnology. Methods of determining biological activity of monocomponents in associated combined di-and trivaccines are disclosed, which contain vaccine strains of measles virus (l-16), epidemic parotitis (l-3) and/or rubella (Orlov).EFFECT: proposed methods make it possible to simplify technology of control of vaccine preparations and reduce cost of production of vaccines.3 cl, 5 tbl, 3 ex
ethod (versions) for capturing particles of interest from mixture // 2606609
FIELD: biotechnology.SUBSTANCE: present invention relates to a method for capturing virus-like particles of interest from a mixture containing destroyed plant cells. Method comprises use of an expanded bed of adsorbent containing resin material, balancing resin material at pH 6.0–8.0 and adding mixture to expanded bed of adsorbent for binding of virus-like particles. Degree of expansion of expanded bed is equal to 1–5. Further, adsorbent is washed. Virus-like particles are eluted from adsorbent.EFFECT: high purity of extracted particles, high process efficiency.17 cl, 9 tbl
Strain of nodular dermatitis virus of cattle dermatitis nodularis bovum, genus capripoxvirus to produce biopreparations for diagnosis and specific prevention of nodular dermatitis of cattle // 2606254
FIELD: veterinary science.SUBSTANCE: invention relates to veterinary virology and biotechnology and concerns strain of virus nodular dermatitis of cattle (VND CATTLE). Described strain is recovered from cows, patients of nodular dermatitis, and deposited in Collection of strains of FGBU "VNIIZT" under registration number - VND KRC/Dagestan/2015 (diagnostic). Strain is reproduced in cultures of cells YDK-04 and TY during 2÷3 days and accumulated in titre from 4.5 to 5.5 lg TCD50/cm3, preserves initial characteristics when passaging in cultures of cells YDK-04 and TY during 5 passages.EFFECT: obtained on its base antigen material can be used for making diagnostics and specific prevention of nodular dermatitis CATTLE.1 cl, 5 dwg, 6 tbl, 7 ex
Strain of influenza virus a/common muskrat/chany lake/226/05 h2n2-subtype for use in diagnostics of influenza virus by methods of rtga and pcr and studying efficacy of antiviral preparations in vitro and in vivo // 2606030
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and concerns influenza virus strain. Presented strain of virus of bird flu A/Common Muskrat/Chany Lake/226/05 H2N2-subtype, deposited in collection of microorganisms of Federal budgetary institution of science "State Research Centre for virology and biotechnology "Vector" under registration number V-623.EFFECT: invention can be used to study the efficacy of therapeutic and preventive preparations for influenza, for preparation of antigen-containing substrate and serum for serodiagnosis of influenza H2-subtype in RTGA, for use as a control reference sample when evaluating specificity of test systems based on polymerase chain reaction, as well as for studying efficacy of antiviral preparations in vitro and in vivo.1 cl, 4 tbl, 4 ex
Reassortant influenza virus strain a/17/silver gull/sarma/06/887 (h6n1) for preparing live influenza vaccine // 2606026
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and concerns influenza virus strain. Proposed a reassortant vaccine strain A/17/silver gull/Sarma/06/887 (H6N1). Strain is produced by crossing virus A/Silver gull/Sarma/51c/2006 (H6N1) with strain A/Leningrad/134/17/57 (H2N2) – donor of attenuation, harmless for adults and children. Strain A/17/silver gull/Sarma/06/887 (H6N1) actively propagates in developing chicken embryos at optimal temperature 33 °C, is characterised by heat sensitivity, cold adaptation and attenuation and immunogenicity for laboratory animals. Strain is deposited in the State collection of viruses FSBU of federal State Research Centre of epidemiology and microbiology of the honorary academician N.F. Gamaley of Ministry of health of the RF at № 2807.EFFECT: invention can be used for producing live influenza vaccine.1 cl, 1 dwg, 2 tbl, 2 ex
Vaccine influenza virus strain a/17/hongkong/2014/8296 (h3n2) for preparing live influenza intranasal vaccine for adults and children // 2606019
FIELD: medicine.SUBSTANCE: invention refers to medical virology and concerns influenza virus strain. Disclosed a vaccine strain A/17/Hongkong/2014/8296 (H3N2)-reassortant, produced by crossing "wild" virus A/Hongkong/4801/2014 (H3N2) with cold-adaptive heat-sensitive virus A/Leningrad/134/17/57 (H2N2) – attenuation donor, safe for humans. Presented strain A/17/Hongkong/2014/8296 (H3N2) actively propagated in chicken embryos at optimal temperature of 32 °C, characterized by temperature sensitivity and cold adaptation and safety for laboratory animals. Strain is deposited in the State collection of viruses FGBU "FNICEM nam. N.F. Gamalei" of the Ministry of Health of Russia, Institute of virology nam. D.I. Ivanovskogo under № 2818.EFFECT: invention can be used in practical health services for preventing influenza incidence in adults and children by a live influenza intranasal vaccine.1 cl, 1 dwg, 5 tbl

Influenza virus strain v/60/phuket/2013/26 for preparing live influenza intranasal vaccine for adults and children // 2605926
FIELD: medicine.SUBSTANCE: invention relates to virology. Disclosed is a vaccine strain V/60/Phuket/2013/26-reassortant, obtained by genetic reassortation of epidemic virus V/Phuket/3073/2013 with cold-adapted temperature-sensitive virus V/USSR/60/69 - attenuation donor, safe for humans. Strain of V/60/Phuket/2013/26 is characterised by temperature sensitivity and cold adaptation and safety for laboratory animals. Strain of V/60/Phuket/2013/26 comprises genes which code surface virus antigens of hemagglutinin (HA) virus and neuraminidase (NA), from an epidemic parent virus V/Phuket/3073/2013 and remaining six genes coding internal non-glycosylated proteins, from attenuation donor V/USSR/60/69.EFFECT: strain of V/60/Phuket/2013/26 can be used in medicine for preventing influenza incidence in adults and children in live influenza intranasal vaccine.1 cl, 4 tbl

Adapted pandemic influenza virus strains a/tomsk/273/2010-ma1(h1n1pdm09), a/tomsk/273/2010-ma2(h1n1pdm09) and a/tomsk/273/2010-ma3(h1n1pdm09) to assess the effect of antiviral drugs (versions) // 2605317
FIELD: medicine.SUBSTANCE: invention relates to general and medical virology and concerns influenza A virus. Obtaining new adapted versions of pandemic influenza A(H1N1)pdm09 strain to organisms of different laboratory animals, proposed three adapted versions of the pandemic influenza virus obtained from wild-type strain A/Tomsk/273/2010(H1N1pdm09) by multiple passing through lungs of experimental mice. Strain A/Tomsk/273/2010-MA1(H1N1pdm09) passed 7 passages through lungs of mice of line BALB/c, strain A/Tomsk/273/2010-MA2(H1N1pdm09) - 12 passages through lungs of mice of line C57BL/6z, and strain A/Tomsk/273/2010-MA3(H1N1pdm09) - 10 passages through lungs of mice of line CD1. All the above strains cause 100 % death rate among mice, to organisms of which they are adapted. Strain A/Tomsk/273/2010-MA1(H1N1pdm09) is high-fatal not only for mice, to the body of which it was adapted (mice of line of BALB/c), but for mice of opposite line C57BL/6z causing among the last 100 % lethality.EFFECT: obtained strains can be used for studying of mechanisms of adaptation of viral pathogens to new host with evaluation of action of antiviral drugs in treating of influenza disease caused by pandemic VG A(H1N1)pdm09.3 cl, 2 dwg, 5 tbl, 5 ex

Vaccine influenza virus strain a/17/bolivia/2013/6585 (h1n1)pdm09 for preparing live influenza intranasal vaccine for adults and children // 2605314
FIELD: medicine.SUBSTANCE: invention refers to medical virology and concerns influenza virus strain. Characterized vaccine strain A/17/Bolivia/2013/6585 (H1N1)pdm09 - reassortant, produced by crossing "wild" virus A/Bolivia/559/2013 (H1N1)pdm09 with cold-adapted heat-sensitive virus A/Leningrad/134/17/57 (H2N2) - donor of attenuation, safe for humans. Strain A/17/Bolivia/2013/6585 (H1N1)pdm09 actively propagated in developing chicken embryos at optimal temperature of 32 °C, characterised by thermal sensitivity and cold adaptation and safety for laboratory animals. Reassortant deposited in State collection of viruses of FGBU "FNICEM nam. N.F. Gamalei" of the Ministry of health of Russia Research Institute of virology. D. I. Ivanovskogo under №2809.EFFECT: invention can be used in practical health services for preventing influenza incidence in adults and children.1 cl, 5 tbl

Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and use thereof // 2604815
FIELD: biotechnologies.SUBSTANCE: invention relates to biotechnology, virology and immunology. Novel adenovirus strains with an improved seroprevalence are described. In one aspect, the present invention relates to isolated polypeptides of adenoviral capsid proteins such as hexon, penton and fiber protein and fragments thereof, and polynucleotides encoding the polypeptides and fragments thereof. Also provided is a vector comprising the isolated polynucleotide according to the invention; adenoviruses comprising the isolated polynucleotides or polypeptides according to the invention, and a pharmaceutical composition comprising said vector, adenovirus, polypeptide and/or polynucleotide. Invention also relates to the use of the isolated polynucleotides, the isolated polypeptides, vector, the adenoviruses and/or the pharmaceutical composition for the therapy or prophylaxis of a disease.EFFECT: disclosed group of inventions can be used in medicine.17 cl, 11 dwg, 4 tbl, 6 ex

Strain a n2166/krasnodarskiy/2013 murrain virus aphtae epizooticae type a for antigenic and immunogenic activity and to produce biopreparations for diagnosis and specific prevention of murrain type a // 2604200
FIELD: veterinary science.SUBSTANCE: invention relates to veterinary virology and biotechnology and concerns new murrain virus strain epizooticae type A fam. Picornaviridae, genus Aphtovirus, which is deposited in collection of FGBU “VNIISZH” under registration number murrain strain 2166/Krasnodarskiy/2013 (production, control of cattle). Presented strain is reproduced in primary trypsinated monolayer swine kidney cell culture (KC), passaged siberian mountain goat kidney cell cultures (PSGK-30), VHK-21 and IB-RS-2. During 18÷24 h of incubation virus yield in said cell cultures reaches 6.0÷7.33 lg TCD50/cm3. Multiplicity of infection (1÷10 TCD/cell) causes CPP after 5 hours, maintaining initial characteristics, when passaging in cell cultures throughout 5 passages.EFFECT: presented strain may be used for antigenic and immunogenic activity and to produce biopreparations for diagnostics and specific prevention of murrain type A.1 cl, 6 tbl, 6 ex

Recombinant strain vv-gmcsf-lact of vaccinia virus, having oncolytic activity and producing granulocytic-macrophagal colony-stimulating factor and oncotoxic lactaptin protein // 2604187
FIELD: biotechnology.SUBSTANCE: invention relates to a recombinant strain of vaccinia virus (VV). Disclosed recombinant strain VV-GMCSF-Lact is constructed based on strain L-IVP vaccinia virus, containing a deletion of virus thymidine kinase gene fragments and growth factor, in areas which are built: gene of human granulocyte-macrophage colony-stimulating factor (GM-CSF), structure of which corresponds to DNA matrix RNA of human GM-CSF, in central part of virus thymidine kinase gene; and lactaptin gene coding fragment of human kappa casein 23-134 a.o., in left terminal area of viral genome. Human GM-CSF gene is expressed under control of natural promoter P7.5 k vaccinia virus and produces secreted form of biologically active human GM-CSF in cells of mammals. Lactaptin gene is expressed under control of synthetic promoter of vaccinia virus P7.5synth and produces oncotoxic recombinant lactaptin protein. Disclosed strain is deposited in State collection of agents of viral infections and rickettsial diseases of FBIS SSC VB “Vector” under number V-688.EFFECT: described strain has high oncolytic activity on human breast cancer cell and can be used in biotechnology.1 cl, 5 dwg, 4 ex

Gene therapy for neurodegenerative disorders // 2603740
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology. Disclosed is a self-complementary adeno-associated virus vector for treating motor neuron disorders such as spinal muscular atrophy, amytrophic lateral sclerosis, spinal bulbar muscular atrophy, spinal cerebellar ataxia, primary lateral sclerosis, and traumatic spinal cord injury. Also described are compositions and methods for treating disorders affecting motor function, such as motor function affected by disease or injury to brain and/or spinal cord.EFFECT: disclosed group of inventions can be used in medicine.16 cl, 17 dwg, 4 ex
ethod of producing bacteriophage // 2603730
FIELD: biotechnology.SUBSTANCE: invention relates to production of a bacteriophage. Disclosed method involves inoculation of bacterial cell suspension in the titre of 108-1012 CFU/ml on a dense nutrient medium with the layer thickness from 3 to 25 mm and cultivation with no foreign microflora, when the air layer thickness over the surface of the dense nutrient medium is from 5 to 50 mm and at optimum temperature for a host strain culture growth. In 30-120 minutes after the beginning of culturing every 30-60 minutes smears are taken from the surface of the dense nutrient medium, coloured with an intercalating dye and microscoped. Cultivation is stopped when reaching at least 10 % in relation to the total amount of cells of the host cell fraction strain with heterogeneous fluorescent cytoplasm staining. Then the obtained lawn of the host strain culture is inoculated with a mother bacteriophage in the titre of 107-1010 BFU/ml. Cultivated for 13-15 hours with no foreign microflora, at the air layer thickness over the surface of the dense nutrient medium from 5 to 50 mm and at optimum temperature for the bacteriophage strain culture growth. Obtained a phage lysate when suspending, sucked off the phage lysate into a sterile container and cleaned. Invention provides reaching a stable high titre of bacteriophage (1012-1014 BFU/ml) when producing phage lysates both at varying formulations of nutrient media and increasing the span variation of values of culturing the host strain and the bacteriophage.EFFECT: invention can be used in biotechnology for obtaining products containing bacteriophages.9 cl

Strain a n2155/baikal/2013 of murrain virus aphtae epizooticae type a for control of antigenic and immunogenic activity and to produce biopreparations for diagnostics and specific prevention of murrain type a // 2603255
FIELD: veterinary science.SUBSTANCE: invention relates to veterinary virology and biotechnology and concerns new murrain virus strain Aphtae epizooticae type A family of Picornaviridae, genus Aphtovirus, deposited in collection of FGBU “VNIIZZH” under registration number murrain strain A No. 2155/Baikal/2013 (industrial). Presented strain is reproduced in monolayer swine kidney cell culture (SC), continuous kidney cell cultures of siberian mountain goat (PSGK-30), VNK-21 and IB-RS-2 during 18÷24 hours of incubation of virus yield in said cell cultures reaches levels of 6.33÷7.5 lg TCD50/cm3. Multiplicity of infection (1÷10 TCD/cell) causes CPP after 5 hours, maintaining initial characteristics, when passaging in cell cultures throughout 5 passages.EFFECT: presented strain may be used for control of antigenic and immunogenic activity and to produce biopreparations for diagnosis and specific prevention of murrain type A.1 cl, 6 tbl, 7 ex

Inactivated sorptive vaccine to fmd types a, o, asia-1 // 2603003
FIELD: veterinary science; biotechnology.SUBSTANCE: invention relates to veterinary virology and biotechnology. Vaccine contains active substance and target additives. As active substance, vaccine contains mixture of avirulent purified antigen material of foot FMD A strains No. 2171/Kabardino-Balkar/2013, A No. 2187/Kuti/2013, Asia-1 No. 1946/Shamir 3/89 and O No. 2123/South Ossetia/2011, obtained from transplantable cell culture VNK-21, representing suspension, containing mainly 146S and 75S immunogenic components of FMD, adjuvants: aluminium hydroxide with saponin and preserving medium in effective ratios.EFFECT: vaccine exhibits high immunogenicity and is capable of providing effective protection against homologous infectious agents, circulating in Transcaucasus, Central Asia, middle and Near East.16 cl, 4 dwg, 7 tbl, 5 ex

Inactivated polio vaccine // 2599453
FIELD: biotechnology.SUBSTANCE: invention relates to a live attenuated recombinant poliovirus, use thereof to produce vaccines, as an inoculum or for preparing a drug, a method of producing such a vaccine and a method of vaccinating a patient. Described poliovirus has a 5' non-coding region consisting of the 5' non-coding region of Sabin 3, modified so that it does not have a base pair mismatch in stem (a) or (b) of domain V, wherein seven or eight of base pairs in stems (a) and (b) are U-A or A-U base pairs; and a capsid protein from Sabin 1, Mahoney, MEF or Saukett strain.EFFECT: presented inventions can be used to produce safe vaccines with improved immunogenic properties against poliovirus.14 cl, 4 dwg, 7 tbl, 6 ex

Antigen delivery platforms // 2597974
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and virology. Described is a self-replicating RNA molecule. Molecule contains first nucleotide sequence coding first protein of herpes virus, and second nucleotide sequence coding second protein of herpes virus. Molecule is intended for producing protein complexes in cell. Invention also discloses alpha-virus replicon particle, containing such RNA molecule, composition containing such alpha-virus, and methods for inducing immune response in subject, using such RNA molecules, alpha-virus, and composition.EFFECT: invention can be applied in medicine.31 cl, 57 dwg, 11 tbl, 7 ex

Recombinant nonpathogenic mdv vector providing poly-specific immunity // 2593950
FIELD: veterinary science. SUBSTANCE: present invention relates to field of veterinary vaccines, in particular to vector vaccines for poultry based on recombinant nonpathogenic Marek's disease virus (npMDV). Invention also relates to methods and applications, including recombinant npMDV, expression cassette, infected host cell and a vaccine. Recombinant npMDV contains heterologous nucleic acid molecule, wherein said nucleic acid molecule contains from 5′-end to 3′-end in following order: a. core early 1 gene promoter of human cytomegalovirus (hCMV-IE1), where said promoter is presented in SEQ ID NO: 1, (b). protein gene fusion (F) Newcastle disease virus (NDV), c. terminator transcription, d. core chicken beta-actin gene promoter, where said promoter is presented in SEQ ID NO: 4, ie. viral protein gene 2 (VP2) virus infectious bursitis (IBDV) classic type. EFFECT: vaccine based on recombinant npMDV, can be used for induction of protective immune response in poultry not only against Marek's disease, but also against Newcastle disease and infectious bursitis treatment. 11 cl, 5 dwg, 3 tbl, 8 ex

Inactivated emulsion vaccine against foot-and-mouth disease types a, o, asia-1 // 2593718
FIELD: veterinary science. SUBSTANCE: invention relates to veterinary virology and biotechnology and concerns a vaccine containing an active substance and target additives. As the active substance the vaccine contains a mixture of avirulent purified antigen materials of the foot-and-mouth disease (FMD) virus strains A No. 2171/Kabardino-Balkar/2013, A No. 2187/Kuti/2013, Asia-1 No. 1946/Shamir 3/89 and O No. 2123/South Ossetian/2011, obtained in the VNK-21 passaged cell culture representing a suspension primarily containing 146S and 75S immunogenic components of the FMD virus. Besides, the vaccine contains a maintenance medium and an oil adjuvant in effective ratios. As the maintenance medium Earle's solution is used without serum with addition of enzymatic muscular tissue hydrolysate, casein medium albumen hydrolysate and antibiotics at the pH of 7.4-7.6. Of oil adjuvants the vaccine contains the Montanide ISA-70 or Montanide ISA-206 oil adjuvant produced by “Seppic” (France). EFFECT: vaccine provides protection against the infection agent circulating in Transcaucasus, Central Asia, Middle and Far East regions. 15 cl, 4 dwg, 8 tbl, 9 ex

North american porcine reproductive and respiratory syndrome (prrs) virus and uses thereof // 2592667
FIELD: chemistry. SUBSTANCE: group of inventions concerns an isolated polynucleotide molecule of nucleic acid which codes North American porcine reproductive and respiratory syndrome (PRRS) virus, a host cell for generation of PRRS virus, transfected by said polynucleotide molecule, vaccine for protection of pigs against infection with PRRS virus, RNA molecule coding PRRS virus, method of generating a PRRS virus in vitro and plasmid for expression of PRRS virus. Described isolated nucleic acid molecule has a sequence presented in SEQ ID NO: 1, 2, 3, 4 or 6. EFFECT: disclosed group of inventions enables to obtain an effective immune response in pigs to North American porcine reproductive and respiratory syndrome virus and can be used in veterinary science. 10 cl, 8 dwg, 10 tbl, 8 ex

Set of oligonucleotide primers for primary structure f newcastle disease virus gene class i // 2590718
FIELD: biotechnology.SUBSTANCE: invention relates to a set of oligonucleotide primers for obtaining a primary structure F of Newcastle disease virus gene class I. Presented set consists of three pairs of oligonucleotides having following structure (5′→3′):Fgene 1F - ATGGGCTCCAGATCTTCTACC, Fgene 560RTTAACAAATTGYTGCATCTTCCCG;Fgene 471F - GCATTGCTGCAACCAATGAGG, Fgene 1008RTGAGGTGTCAAGYTCTTCTATCAC;Fgene 898F - CGTGCCACCTACYTGGAAAC, Fgene 1663RTCACATTTTYGTAGTGGCYCTC. Presented oligonucleotides avoid cross-reactions with related species, make it possible to limit manipulation of single-stage procedure of polymerase chain reaction (PCR). Developed primers enable to obtain full information on F genes of Newcastle disease virus, their belonging to any genetic line virus, presence of nucleotide/amino acid substitutes in genome of pathogen.EFFECT: invention can be used for diagnostic purposes for identification of Newcastle disease virus in virology and veterinary science, as well as to solve scientific and research tasks on study of said virus.1 cl, 1 dwg, 2 tbl, 3 ex

ethod of purifying bacteriophages // 2590609
FIELD: biotechnology.SUBSTANCE: present invention relates to a method of purifying bacteriophages. Described method includes: a) culturing a bacterial host strain on an appropriate medium, inoculating said culture with a bacteriophage and obtaining a bacteriophage lysate; b) purifying lysate using affinity chromatography; c) using resulting filtrate to prepare a purified bacteriophage, wherein in stage a) bacterial host strain used consists of bacterial cells containing a sequence encoding a fusion protein containing a foreign polypeptide exhibiting an affinity for a chromatography resin used in stage b) and a polypeptide from among structural phage proteins of bacteriophage present in resulting lysate, and said polypeptide having affinity for chromatographic resin, selected from a group comprising His-tag and GST.EFFECT: disclosed invention enables single-stage and simultaneously time-efficient purification of phage preparations for therapeutic purposes and ensures preservation of antibacterial activity of bacteriophage in case of displacement of bacteriophage from resin, and in case of proteolytic release.5 cl, 10 dwg, 1 tbl, 1 ex

Recombinant strain l-ivp 1421abjcn pox virus virulence genes with broken a56r, b8r, j2r, c3l, n1l for producing live culture of attenuated smallpox vaccine and other orthopoxviruses, pathogenic for humans // 2588388
FIELD: biotechnology.SUBSTANCE: described is a recombinant attenuated strain of vaccinia virus with broken virulence genes ΔA56RΔB8RΔJ2RΔC3LΔN1L (1421ABJCN) based on cloned LIVP strain of vaccinia virus. Technical result of proposed invention consists in creation using five plasmids integration of highly attenuated recombinant vaccinia virus strain for producing safer live culture of attenuated smallpox vaccine and other orthopoxviruses, pathogenic for humans. Said technical result is achieved by obtaining recombinant strain L-IVP 1421ABJCN vaccinia virus with broken virulence genes A56R, B8R, J2R, C3L, NIL, intended for producing live culture of attenuated smallpox virus vaccine and other orthopoxviruses.EFFECT: invention can be used in medicine, biotechnology, particularly genetic engineering for producing live culture of attenuated smallpox vaccine and other orthopoxviruses, pathogenic for humans.1 cl, 9 dwg, 5 tbl, 12 ex

Improved methods of purifying vectors based on recombinant aav // 2588387
FIELD: biotechnologies.SUBSTANCE: invention relates to biotechnology and virology. Described is method of purifying vectors based on recombinant adenoassociated virus (rAAV). Vectors based on recombinant AVV according to invention deprived of technological impurities, including components of product, such as cell nucleic acids, cell proteins, helper virus and components.EFFECT: method involves bringing stream of initial materials in contact with medium for chromatography on apatite in presence of polyethylene glycol (PEG) and elution of rAAV particles using elution buffer containing less than 3 % (wt/Vol) PEG.34 cl, 7 dwg, 6 tbl, 13 ex

Reassortant influenza virus strain rn9/13-human a(h6n9) for neuraminidase antibody assay in influenza infection and vaccination // 2587629
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, virology and medicine. Diagnostic influenza virus strain RN9/13-human A (H6N9) is obtained by crossing apatogenic bird flu virus a/silver gull/Sarma/51 c/06 (H6N1) with cold-adapted vaccine strain a/17/Anui/2013/61(H7N9) based on attenuation donor A/Leningrad/134/17/57 (H2N2). Strain has neuraminidase influenza virus subtype N9 A/Anui/1/2013(H7N9) and avian influenza virus hemagglutinin and/silver gull/Sarma/51c/06(H6N1). Strain RN9/13-human A(H6N9) actively propagates in developing chicken embryos at optimum temperature of 33 °C, which enables to accumulate viral material for further purification and concentration.EFFECT: strain RN9/13-human A(H6N9) can be used for detection of antibodies to influenza virus neuraminidase N9 in blood serum using solid-phase reaction of inhibiting neuraminidase activity and post-adsorption micro-neutralisation reaction in MDCK cell culture.1 cl, 2 dwg, 1 tbl, 1 ex

Hepatitis b virus surface antigen epitope and use thereof // 2585525
FIELD: pharmaceutics.SUBSTANCE: set of inventions concerning epitope specific for hepatitis B virus (HBV), polynucleotide coding epitope, expression of recombinant vector, recombinant microorganism, virus or cells of mammals, method of producing epitope and method for producing antibody specifically bound to epitope. Described epitope is conservative position HBV, which is not subjected to mutagenesis.EFFECT: presented group of inventions can be used to obtain compositions with high therapeutic efficiency due to absence of possibility of mutations in used epitope.22 cl, 8 dwg, 5 tbl, 3 ex

Production of pox viruses and composition of pox viruses // 2581910
FIELD: bioengineering.SUBSTANCE: claimed invention discloses the composition including the recombinant modified virus of the Ankara variolovaccine. Note here that the said recombinant modified virus of the Ankara variolovaccine is the EEV-type without directed infective specificity.EFFECT: invention can be used in cancer or infectious disease treatment.11 cl, 3 dwg, 3 tbl, 2 ex
ethod of improving efficiency of baculovirus drugs // 2581794
FIELD: biotechnologies.SUBSTANCE: invention relates to protection of plants. Disclosed is method of increasing efficiency of baculovirus preparations. Method involves infecting insects with nuclear polyhedral disease virus, for this purpose worms of I-III ages are fed during 2 days with nutrient medium containing 103-104 polyhedron per 1 mg of medium. In 2-5 days after infection external treatment of insect is performed using spray gun with aqueous solution of conservative short 18 nucleotides with length of gypsy moth nuclear polyhedral disease virus antisense fragment antiapoptotic gene of IAP-3 with sequence of 5′-CGACGTGGTGGCACGGCG-3′ in concentration of 10 pmol/mql.EFFECT: invention provides faster action of baculovirus preparations.1 cl

Bacteriophage possessing anti-pseudomonas aeruginosa activity, bacteriophage proteins and methods for using them // 2580248
FIELD: medicine.SUBSTANCE: present invention refers to bacteriophage therapy for treating and controlling bacterial infections. The presented group of inventions concerns a recovered bacteriophage possessing anti-Pseudomonas aeruginosa bacteriophage, proteins coded by a genome of this bacteriophage, a pharmaceutical composition containing these proteins and applicable for producing a medicinal agent for treating an infection caused by Pseudomonas aeruginosa, a diagnostic technique for a bacterial infection caused by Pseudomonas aeruginosa, and a method for reducing or inhibiting Pseudomonas aeruginosa colonisation or growth on a solid surface.EFFECT: presented group may be used in hospitals for the selective treatment of infections caused by Pseudomonas aeruginosa, causing no effect on the normal ambient flora.30 cl, 228 dwg, 1 tbl, 8 ex

ethod of production of virus-like particles of plants // 2579903
FIELD: bioengineering.SUBSTANCE: plants or plant material containing VLP localised in apoplast are produced. Mixture of protoplasts/spheroplasts and apoplasts is produced by the plant or plant material treatment by the multicomponent enzymatic mixture destructing the cell walls, and containing cellulase. Fraction of protoplast/spheroplast and fraction of apoplast are produced from mixture of protoplasts/spheroplasts and apoplasts. Fraction of apoplast is extracted, wherein it contains VLP. VLP is extracted from apoplast fraction.EFFECT: invention ensures with high efficiency the extraction of the virus-like particle.43 cl, 12 dwg, 15 tbl, 9 ex

Strain of "kaluga 2014" african swine fever virus for monitoring research and study of pathogenesis // 2577997
FIELD: veterinary science.SUBSTANCE: invention refers to veterinary virology and concerns the strain of the African swine fever virus. Strain is recovered from a killed boar in hunting farm "Lake" of Medyn district of Kaluga area in 2014, certified with the name "Kaluga-2014" and deposited in the national collection of Russian Research Institute for Veterinary Virology and microbiology of agricultural sciences under no. 3115. Strain has high infectious activity, and is accumulated in bone marrow cell cultures of pigs and pig leucocytes in titre 6.0-7.0 lgGAE50/cm3. Loss of infected pigs occurs with signs of acute ASF in 6-8 days after development of clinical evidences of disease.EFFECT: invention can be used as reference strain during monitoring studies in the Russian Federation with new isolates virus circulating in a population boars, as well as selected from a domestic pig.1 cl, 3 tbl, 3 ex

Semistable production of lentivirus vectors // 2577982
FIELD: bioengineering.SUBSTANCE: suggested system of the stable expression of lentivirus proteins comprises the hybrid vector containing a baculovirus framework, in its turn containing an integration casette, the flanked ITR AAV, containing two expression cassettes, and the expressing plasmid containing an open reading frame (ORF) Rep AAV. Wherein the first cassette encodes the lentivirus genes gag and pol, and second cassette encodes the rev and a selected marker. The system ensures the production of the line of cells containing structural and regulatory proteins HIV gag/pol and rev used to produce LV. The inventions can be used in gene therapy.EFFECT: increased stability.19 cl, 3 dwg, 4 tbl, 3 ex

Stable production of lentivirus vectors // 2577979
FIELD: bioengineering.SUBSTANCE: inventions relate to the methods of production of the stable line of lentiviruses packing cells (versions), the stable line of the lentiviruses packing cells, the method of producing the lentivirus vectors, the line of cell-producers, and the method of producing the lentivirus vectors. The suggested inventions are made using the hybrid system of baculo-AAV for the stable expression of structural and regulatory lentivirus proteins. Such a system contains the baculovirus framework, containing an integration cassette, flanked ITR AAV, in a combination with the plasmid coding a rep protein. The suggested diagram ensures the stable integration of the structural and regulatory proteins HIV-1 gag/pol and rev, and production of the first intermediate product containing only structural and regulatory proteins HIV gag/pol and rev, used as the input point to produce the stable lines of the packing cells, as well as the lines of cells-producers. The inventions can be used in gene therapy.EFFECT: increased stability.30 cl, 6 dwg, 6 tbl, 6 ex
ethod of extracting bacteriophage bordetella bronchiseptica // 2577608
FIELD: biotechnologies.SUBSTANCE: method relates to microbiology and biotechnology. Method of extracting Bacteriophage Bordetella bronchiseptica includes ultraviolet radiation inducing mutagenic action having wavelength of 250-260 nm on cell lysogenic bacterial cultures Bordetella bronchiseptica, grown on a solid agar medium. UV radiation exposure time is equal to 1 day 5-7 minutes, in 2 day - 7-10 minutes, in 3 day - 7-10 minutes. Distance from the irradiated cells of lysogenic bacterial cultures Bordetella bronchiseptica to UV emitter in 1 day is 1 metre, in 2 day-1 m in 3 days - 0.5 m.EFFECT: disclosed method enables a relatively short time of isolating bacteriophages of lysogenic bacterial cells Bordetella bronchiseptica without using antibacterial preparations.1 cl, 1 tbl

ultivalent immunogenic compositions pcv2 and methods for producing these compositions // 2577127
FIELD: medicine.SUBSTANCE: group of inventions refers to medicine, namely to veterinary science, and can be used to produce a unit multivalent combined vaccine. The vaccine contains a porcine circovirus type 2 antigen that is a protein coded by a DNA sequence which is at least 80% identical to ORF3 of porcine circovirus type 2, and one porcine reproductive and respiratory syndrome virus, and one or more pharmaceutically acceptable carriers. The group of inventions also refers to using one dose of the multivalent combined vaccine.EFFECT: using this group enables to produce the synergetic effect of administering the combination of PCV2 ORF2 and InglVac PRRS MLV in the same dose of the vaccine to relief the symptoms related to porcine circovirus type 2 infection.16 cl, 20 dwg, 24 tbl

Strain o №2108/zabaikalsky/2010 of foot-and-mouth disease virus aphtae epizooticae of type o for manufacturing biological preparations for diagnostics of foot-and-mouth disease virus of type o // 2575801
FIELD: veterinary medicine.SUBSTANCE: picornaviridae, of genus Aphtovirus, deposited in the collection of FSBI "ARRIAH" under the registration number of foot-and-mouth disease virus of type O No. 2108/Zabaikalsky/2010. The presented strain is reproduced in primary trypsinised monolayer porcine kidney (PK) cell culture, passaged cultures of kidney cells of Siberian mountain goat (SMGK-30) and porcine kidney (IB-RS-2). During the 18-24 hours of incubation the virus yield in the said cell cultures reaches values of 6.25-6.75 lg 50% TCD50/cm3. At high multiplicity of infection (1-10 TCD/cell) causes TCID after 5 hours, while maintaining the initial characteristics when passaging in cell cultures for 10 passages.EFFECT: strain may be used to control the antigenic and immunogenic activity of foot-and-mouth vaccines and for manufacture of biological products for diagnostics of foot-and-mouth disease of type O.5 cl, 1 dwg, 7 tbl, 4 ex

Bioadditive to nutrient medium for cultivation of animal cells and reproduction of viruses on thereof // 2575797
FIELD: chemistry.SUBSTANCE: invention relates to biotechnology. Claimed is bioadditive to nutrient medium for cultivation of animal cells and reproduction of viruses on thereof, which represents extract from marrows and pike muscles. Said extract is obtained by extraction of milled by homogeniser tissues of marrows and pike muscles with Hanks' solution in ratio 1:3 at temperature 1-2°C for 24 hours, centrifugation and collection of supernatants. Freezing of supernatants at temperature -20°C for 5-7 days, defrosting at temperature 4-20°C and purification are realised. Obtained extracts of vegetable and animal origin are mixed in ratio 1:1 with further sterilisation by filtration. Obtained extract is characterised by the following parameters: optical density 0.081±0.004 units opt. den., pH 7.26±0.04, content of total protein 9.1±0.04 g/l, free haemoglobin 0 g/l, total lipids 0.15±0.07 g/l, total cholesterol 0.02±0.1 mmol/l.EFFECT: invention provides increased growth of animal cells and reproduction of viruses on thereof.6 tbl, 5 ex

Recombinant adenovirus containing trans-splicing mediating ribozyme, and anti-cancer therapeutic gene, and using it // 2575620
FIELD: medicine, pharmaceutics.SUBSTANCE: recombinant adenovirus, a pharmaceutical composition containing this virus, and a method of treating cancer with using this virus are presented. The characterised recombinant adenovirus containing a polynucleotide coding a complex of trans-splicing mediating rybozyme, and HSVtk (herpes simplex virus thymidine kinase), wherein the trans-splicing mediating rybozyme represents rybozyme Rib67, and wherein a trans-splicing mediating rybozyme target is cancer-specific TERT (telomerase reverse transcriptase) gene mRNA and an anti-cancer therapeutic gene coding sPD-1 (soluble programmed dead protein 1). The recombinant adenovirus possesses cancer cell selectivity caused by the trans-splicing mediating rybozyme, and enhanced anti-cancer activity caused by the anti-cancer therapeutic gene.EFFECT: presented inventions can be used for the effective prevention and treatment of cancer.5 cl, 23 dwg, 13 ex

Strain of african swine fever virus of 8th serotype adapted for intertwined culture of cells cos-1 // 2575079
FIELD: biotechnologies.SUBSTANCE: strain of the virus of the African swine fever of the 8th serotype, Asfarviridae family, Asfivirus sort, is adapted to the intertwined culture of the cells COS-1 and is deposited in the Collection of microorganisms of GNU VNIIVViM of the Russian Agricultural Academy under the No. 3096.EFFECT: invention can be used for development of diagnostic preparations and conducting of virologic, molecular and genetic studies.2 dwg, 1 tbl, 2 ex

Herpetic fever virus vaccines // 2575067
FIELD: biotechnologies.SUBSTANCE: replication-deficient, dominant and negative recombinant virus of herpetic fever 2, the vaccine and the method of patient immunisation against the infection HSV-1 or HSV-2 are offered. The recombinant virus contains two sequences coding D HSV-2 glycoprotein, linked with ICP4 promoters in the genome, the latter are connected with the sequences of tetracycline operators, and two sequences coding UL9-C535C protein which are linked with hCMV promoters linked with the sequences of tetracycline operators. Note that the virus doesn't contain the sequence coding ICP0 protein. The vaccine containing the named recombinant virus is safe and efficient against the infections HSV-1 or HSV-2 due to expression of the dominant and negative form of UL9-C535C polypeptide and use of tetracycline-induced activation and deactivation of genes. The method of immunisation of patients against HSV-1 or HSV-2 using the offered vaccine is also offered.EFFECT: offered vaccine and the method of patient immunisation can be used in medicine for transformation or suppression of breakout of HSV-1 or HSV-2.17 cl, 19 dwg, 1 tbl, 1 ex

Bacteriophage-containing room deodorant // 2574023
FIELD: medicine.SUBSTANCE: room deodorant contains a concentrate of selected high-avidity bacteriophages of the species Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, Salmonella enterica, Proteus mirabilis, Proteus vulgaris, Klebsiella pneumoniae, Yersinia pseudotuberculosis, Yersinia enterocolitica, Pseudomonas aeruginosa. The concentrate of the above bacteriophages possesses Appelman's lytic activity 10-8 of each bacteriophage. The bacteriophages are grown on a dense medium and purified by ultrafiltration. The above agent contains a perfume compound and isothiozolinone-based preserving agents not reducing bacteriophage activity. Bacteria nutrients are absent.EFFECT: using the invention provides eliminating unpleasant odours and bacteria of the species Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, Salmonella enterica, Echerichia coli, Proteus mirabilis, Proteus vulgaris, Klebsiella pneumoniae, Yersinia pseudotuberculosis, Yersinia enterocolitica, Pseudomonas aeruginosa, as well as prevents bacterial infections caused by the above bacterial species.3 tbl

ethod for obtaining bacteriophage strain, specific strains of bacteriophages and their application // 2573934
FIELD: chemistry.SUBSTANCE: group of inventions relates to method for identification of bacteriophage strain, versions of bacteriophage strain and their application. Method includes obtaining collection of strains of bacteriophages, cultivation of Salmonella spp strain on sterile culture medium, application of culture samples on plate, addition of suspension of tested bacteriophage strain in concentration 6.5 x 109 pfu, with ratio of bacterial suspension to suspension with phage 1:1, 1:1.5 or 1:3 and incubation at 37°C for 4 h. Resazurin is added to culture samples with further incubation in darkness at 37°C for 3 h. Colour and fluorescence of culture are controlled. Bacteriophage strain, contained in culture, preserving blue colour or not demonstrating significant increase of fluorescence in comparison with control, is identified as bacteriophage strain, specific to selected pathogen. Also claimed are bacteriophage strain PCM F/00069, bacteriophage strain PCM F/00070 and bacteriophage strain PCM F/00071 and their application for preparation obtaining.EFFECT: group of inventions provides effective screening of bacteriophages, as well as 200 fold reduction of infection a week after termination of treatment with bacteriophage-based preparation.8 cl, 7 dwg, 11 tbl, 3 ex

etapneumovirus of birds in oncolysis // 2571925
FIELD: biotechnologies.SUBSTANCE: use of live metapneumovirus of birds (AMPV) and pharmaceutical composition containing cytotoxic quantity of such virus, in therapies of malignant tumours, and also the method of therapy of malignant tumours using the named pharmaceutical composition are offered.EFFECT: metapneumovirus of birds is characterized by the expressed cytolytic action on tumour cells, and the pharmaceutical compositions containing cytotoxic quantity of this virus can be used in medicine in the methods of therapy of malignant tumours as an alternative instead of pharmaceutical compositions containing known oncolytic viruses.17 cl, 1 dwg, 3 tbl, 2 ex

Recombinational cartridge containing genes ep153r and ep402r of strain f-32 of african swine fever virus and recombinant strain dswcongo/francelectincd2 of african swine fever virus // 2571858
FIELD: biotechnologies.SUBSTANCE: recombinant strain of the African swine fever virus with replacement of the genes EP153R and EP402R is offered which contains the reporter gene EGFP coding green fluorescent protein. The strain DswCongo/FranceLectinCD2 is obtained from the attenuated strain KK-262 of the African swine fever virus by homologous recombination. The strain comprises the genes EP153R and EP402R from the strain FK-32 of the African swine fever virus. The recombinant strain is not pathogenic for pigs at intramuscular infection in the dose 2*106 GAE 50/cm3. The recombinational cartridge for obtaining of the recombinant strain DswCongo/FranceLectinCD2, which is a plasmid on the basis of the vector pUC19 containing fragments of the genes EP152R and EP364R of the strain KK-262 of the African swine fever virus, the full-size genes EP153R and EP402R of the strain F-32, and also the reporter gene EGFP is also offered.EFFECT: invention can be used in scientific research institutes for study of role of proteins of the African swine fever virus in reproduction of the virus in cell cultures, in susceptible animals, and also their functions in modulation of immune response.2 cl, 2 dwg, 1 tbl, 3 ex

Virus-like particles containing target proteins fused with coat proteins of plant viruses // 2571223
FIELD: medicine, pharmaceutics.SUBSTANCE: presented group of inventions concerns a virus-like particle and methods for using and producing the same. The presented virus-like particle substantially free from viral nucleic acid is formed of a fused protein containing a coat protein of a plant virus, and a target protein. The target protein is produced of a cell surface polypeptide of an intracellular pathogen, whereas the coat protein of the plant virus is specified in a group of Alfalta mosaic virus, Aleppo grass mosaic virus and potato virus Y. Immunogenic formulations containing these virus-like particles may be introduced into patient's body to stimulate protective immune responses. The method for producing the virus-like particles involves a process of fused protein expression in a host cell in the environment adequate to enable assembling the virus-like particle from the above fused protein.EFFECT: characterised inventions enable reproducing a desired antigen determinant or a foreign peptide on the surface of the virus-like particle free from nucleic acid, for the purpose of immunisation.24 cl, 13 dwg, 3 tbl, 9 ex
ethod for viral polyhedron decontamination // 2570553
FIELD: medicine.SUBSTANCE: method refers to virology and concerns a method for viral polyhedron decontamination. The invention involves homogenising dead insect biomass, centrifuging and precipitating. A viral polyhedron suspension is pre-shaken and centrifuged until a white fraction of viral polyhedrons appears above precipitated insect tissues. A supernatant with polyhedrons is removed into a new test tube and added with a three-molar guanidine thiocyanate solution, centrifuged once again; the supernatant is removed; the test tube is added with water and re-suspended on a centrifuge. Precipitated polyhedrons are added with TE buffer, kept for 180 s at temperature of +25 degrees Celsius, centrifuged; the supernatant is removed; the precipitate contains decontaminated polyhedron viruses.EFFECT: invention is applicable in an entomopathogenic-virus insecticide technology as an intermediate stage of virus recovery from dead insects.1 ex
 
2551036.
Up!