Biochemistry and beer and spirits and wine and vinegar and microbiology and enzymology and mutation or genetic engineering (C12)

C   Chemistry; metallurgy(311501)
C12            Biochemistry; beer; spirits; wine; vinegar; microbiology; enzymology; mutation or genetic engineering(33233)
Attenuated strain "msc-2015 vniivvim" of african swine fever virus serotype viii for virology and molecular-genetic analysis // 2607791
FIELD: medicine.SUBSTANCE: invention relates to virology. Attenuated strain “SKA-2015 VNIIVViM” of african swine fever virus serotype VIII is disclosed. Strain is produced by intermittent passages and selection of virulent strain "Stavropol 01/08" in primary cell culture of LS and transplantable hybrid cell line A4C2/9k and it is deposited in State collection of strains of microorganisms GNU Rosselhozakademii VNIIVViM under No. 1847.EFFECT: strain "MSC-2015 VNIIVViM" can be used during virological, molecular-genetic research, studying immunogenesis of disease, development of diagnostic and vaccine preparations.1 cl, 4 tbl, 4 ex
Biological product for stimulating the growth of plants and their protection against phytopathogens on the basis of strains of trichoderma, strains of trichoderma for the production thereof (variants), method for producing a biological product on the basis of such strains // 2607785
FIELD: biotechnology.SUBSTANCE: group of inventions relates to biotechnology and can be used to create bioprotection of plants against phytopathogens and to stimulate their growth. Group of inventions comprises the strains of the fungus of Trichoderma longibrachiatum species (3 options); biological product for stimulating the growth of plants and their protection against phytopathogens on the basis of these strains and the method for producing a biological product. Strains of the Trichoderma longibrachiatum fungus are deposited at the ARRIAM FSBSI under registration numbers: RCAM 03324, RCAM 03323, RCAM 03325 respectively. Biological product contains spores and fragments of mycelium of above strains from 2×109 to 4×109 CFU/cm3; has antagonistic activity against phytopathogenic fungi of the Fusarium and Cladosporium species. Method of producing a biological product involves a two-stage joint cultivation of strains in a quantitative ratio of 1:1:1 consistently on two nutrient media for 4–5 days. This group of inventions provides increase in seed germination on 4–15 % and the increase of linear sizes of plants on 0.5–24 %.EFFECT: increased seed germination and the increase of linear sizes of plants.5 cl, 2 tbl, 5 ex
Bioreactor for growing methane-recycling microorganisms // 2607782
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Disclosed is a bioreactor for growing methane-recycling microorganisms with possibility of using methane-containing gas and oxygen-containing gas as substrates for cell growth. Bioreactor is a vertical cylindrical housing with a cover, bottom and central circulation pipe. In upper part of housing of bioreactor on opposite sides there are two closed sectors. Closed sectors form an external reaction volume, each sector is equipped with pipes to feed gaseous substrate for discharge of gas-liquid dispersion medium and to feeding a liquid stream into lower part of sector. Discharge pipe is connected with central circulation pipe, liquid stream feed pipe is connected with pipe for extraction of culture liquid from bottom of bioreactor. In each closed sector there is a mixing device with a logical device.EFFECT: higher efficiency with simultaneous reduction of power consumption, as well as possibility of making a bioreactor in proposed design of different volume.13 cl, 1 dwg
ethod of producing liquid sterile nutrient mediums for operation with cells of mammals // 2607648
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Method of producing liquid sterile nutrient medium is disclosed. Method involves dissolving of dry components of nutrient medium in optimum volumes of solvent and sterilization of obtained solutions. Dissolution is performed for 5–10 minutes in ultrasonic bath with generator frequency of 37 kHz and amplitude of oscillations in range from 5 to 20 microns. Sterilizing ultrafiltration is carried out using cascade of three series-arranged membrane filters with pore size of 0.45–0.22–0.1 mcm and efficiency of filtration from 100 to 1,000 ml/min.EFFECT: invention provides production of nutrient medium for cell biology in required volumes immediately before planned works, higher reliability and quality of operations with cells of mammals.3 cl, 1 tbl, 1 dwg
System providing reaction catalyzed with perhydrolase // 2607481
FIELD: packaging industry.SUBSTANCE: group of inventions relates to package for composition components separate storage before use, containing deformable material, capable of forming at least two tight chambers, where package contains: first chamber and second chamber, where chambers are separated by one or more barriers, which are fragile or tearable, where first chamber contains low viscosity liquid solution, containing enzyme having perhydrolic activity and containing SEQ ID NO: 1, and where second chamber comprises triacetin and peroxide source selected from carbamide peroxide, polyvinylpyrrolidone-complexes of hydrogen peroxide, sodium percarbonate, sodium perborate and peroxides of metals; as well as to kit and method of dental whitening. Invention allows to preserve components composition separately before use, with components higher stability during long-term storage.EFFECT: invention provides creation of gel-like product, which components are mixed in effective and simple method at the moment of use.8 cl, 2 ex, 6 tbl, 2 dwg
ethods of producing viral particles with simplified surface proteins' glycosylation // 2607452
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology. Method for production of influenza virus with monoglycosylated hemagglutinin-antigen (HA-antigen) is disclosed. Method involves cultivation of influenza virus, containing hemagglutinin-antigen in specific pathogen free (SPF) chicken egg with embryo with an effective amount of mannosidase inhibitor, concentration of which is sufficient for inhibiting of α-mannosidase I in the path of N-glycosylation followed by extraction of produced influenza virus. Further contact of extracted influenza virus with endoglycosidase (EndoH) leads to production of influenza virus, having monoglycosylated influenza virus HA-antigen.EFFECT: disclosed method enables to obtain influenza virus with monoglycosylated hemagglutinin-antigen (HA-antigen) with high yield using specific pathogen free (SPF) chicken eggs with embryo, and can be used for producing monoglycosylated hemagglutinin-antigen in production of vaccines.19 cl, 4 dwg, 4 ex
Cassette genetic construct expressing two biologically active sirna, effectively attacking targets in reverse transcriptase mrna of subtype a hiv-1 in russian patients, and one sirnk targeted to mrna of ccr5 gene // 2607381
FIELD: medicine.SUBSTANCE: invention relates to medical and molecular genetics, and concerns cassette genetic construct. Presented cassette construct anti-HIV-1R-anti-HIV-2R-anti-CCR5-8 is obtained on basis of vector GeneClip-U1-neo and contains insert, expressing three hairpin-RNAs coding siRNA inhibitors of human immunodeficiency virus type 1 subtype A and human CCR5 gene expression and two fragments of genome of HIV-1 subtype A, found in Russian patients, and corresponding to two conservative areas of reverse transcriptase domain (are given in first and second lines respectively), as well as 19-bp area corresponding to CCR5 gene (is brought into third line): where lower case shows area of loops between parts of palindromes that can form double-stranded duplexes.EFFECT: invention can be used to suppress expression of versions of virus in Russian patients.1 cl, 3 dwg, 3 tbl, 2 ex
ethods of purifying cells, derived from pluripotent stem cells // 2607380
FIELD: biotechnology.SUBSTANCE: present invention relates to methods of differentiation of pluripotent stem cells. In particular present invention discloses methods for characterizing cells, differentiated into cells, expressing markers, characteristic for pancreatic endocrine cell line, based on analysis of unique cell surface markers. Present invention also discloses methods of enriching or sorting cells, expressing markers, characteristic for pancreatic endocrine cell line.EFFECT: present invention also discloses methods of reducing number of cells, which can be harmful for cell population, expressing markers, characteristic for pancreatic endocrine cell line, formed by methods, which are subject of this invention, thereby reducing rate of tumors in vivo after transplantation.13 cl, 13 dwg, 7 tbl, 7 ex
ethod of bioconversion of crop residues of agricultural crops // 2607378
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and can be used in improvement of soil fertility in biological agriculture. Mix the remnants of the content of the rumen of cattle slaughter of ruminants, containing microorganisms and molasses at a ratio of 1:10. Before use is diluted with water in an amount of 1 l of the prepared solution per 100 l of water, and produced mixture in an amount of 10 l/ha is diluted with alcohol dreg in amount of 200 l/ha and irrigated area with subsequent ploughed.EFFECT: invention allows to simplify the method of bioconversion and accelerating decomposition of crop residues.1 cl, 1 ex
Production of active highly phosphorylated n-acetylgalactosamine-6-sulphatase and use thereof // 2607376
FIELD: biotechnologies.SUBSTANCE: group of inventions relates to biotechnology. Disclosed is method of producing a composition containing purified recombinant human N-acetylgalactosamine-6-sulphatase (GALNS) enzyme, where GALNS enzyme includes amino acid sequence identical to at least by 95 % to 27–522 amino acids of SEQ ID NO: 4 sequence. Disclosed are compositions containing effective amount of human recombinant enzyme N-acetylgalactosamine-6-sulphatase (GALNS).EFFECT: group of inventions enables to obtain large amount of human GALNS enzyme, 98 % of which is presented in form of precursor, and can be used in preparing drug for treating of type IVa (MPS IVa) mucopolysaccharidosis or A type Morquio syndrome.9 cl, 19 dwg, 19 tbl, 14 ex
ethod of prediction of clinical outcome of reactive and infectious arthritis // 2607375
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and can be used for prediction of the favorable or unfavorable outcome of infectious and reactive arthritis. Method envisages fecal collecting in the patient for bacteriological examination on microflora after completing the course of antibacterial therapy. Carry out sowing faeces at a dilution of 10-5 on a Petri dish with 1.5 % GRM-agar and antibacterial preparation, used in treating the given patient, in minimum inhibitory concentration in the range of stability, with followed incubation and counting grown on the cup colonies of microorganisms. Thus when the content of colonies in an amount of less than 5,000 CFU/g predict the favorable outcome of arthritis. At content of colonies in an amount equal or larger than 5,000 CFU/g, predict the unfavorable outcome of arthritis.EFFECT: invention allows to simplify the method for prediction of the favorable or unfavorable outcome of reactive and infectious arthritis.1 cl, 1 dwg, 2 tbl, 3 ex
Versions of albumin // 2607374
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology, namely to production of versions of albumin with changed half-life period in plasma in comparison with initial albumin, and can be used in medicine. Version of albumin is obtained, containing one or more substitutes relative to SEQ ID NO: 2, selected from following: 1) E492A, C, D, F, G, H, I, K, L, M, N, Q, R; 2) K500I, R; 3) N503H; 4) E505Q; 5) H510D; 6) D550E, H, I, M, N, R, S, W; 7) K573A, C, D, F, G, H, I, L, M, N, P, R, S, V, W, Y; 8) K574D, F, G, H, I, L, M, P, R, S, T, V, W, Y; 9) A578F; 10) S579C; 11) Q580I, K, M, R, V; or 12) G584D.EFFECT: invention enables to obtain version of albumin or its fragment, capable to bind with FcRn, or chimeric polypeptide, including said version of albumin or its fragment, with longer half-life period in plasma or increased binding affinity with FcRn in comparison with initial albumin, its fragment or chimeric polypeptide.10 cl, 32 dwg, 22 tbl, 22 ex
odification of group 6 poaceae (bluegrass) allergens with low allergenic capacity due to mutagenesis of proline residues // 2607373
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology, namely to recombinant modifications of group 6 Poaceae (bluegrass) allergens, and can be used in medicine for preventing or treating type 1 allergies, in initiation of which group 6 bluegrass allergens are involved. Recombinant allergen Phl p 6 is obtained, in which prolines, corresponding in linearized form to prolines in positions 29, 30, 57 and 79 of amino acid sequence of wild type protein Phl p 6 in compliance with SEQ ID NO: 2, are mutated separately or in combination by point mutations, selected from deletions and substitutions of amino acids.EFFECT: present invention enables to obtain recombinant allergen Phl p 6 with low IgE reactivity, compared to existing non-mutated allergens, and with substantially preserved T-lymphocytes reactivity at the same time.12 cl, 20 dwg, 2 tbl, 3 ex
Diagnostic technique for plant material for transgenicity // 2607372
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry, in particular to diagnostic technique for vegetable material on transgenicity. Method involves extraction of DNA from biomaterial and carrying out of polymerase chain reaction in real time with probes, marked by fluorescent dyes and fluorescence extinguishers. Wherein reaction mixture is made, containing primers aacacatgagcgaaacccta, caagctcgagtttctccata, ccggtcttgcgatgattat, tatattttgttttctatcgcgtatt, tatattttgttttctatcgcgtatt, agatggattgcacgcaggttc, gcatcagagcagccgattgt and probes FAM-cccttatctgggaactactcacacatta-BHQ1, FAM-tgcgggactctaatcataaaaacccatct-BHQ1, FAM-ccagtcatagccgaatagcctctccacc-BHQ1. Polymerase chain reaction is carried out in real time with continuous fluorescence control and its exponential rise shows transgenicity of plants.EFFECT: invention allows effective diagnosis of plant material for transgenicity.1 cl, 2 dwg, 1 tbl
Strain of lactic acid bacteria, drug, food product, beverage, as well as fodder containing strain of lactic acid bacteria // 2607370
FIELD: biotechnology.SUBSTANCE: group of inventions relates to biotechnology. Strain Lactobacillus paracasei MCC1849 with high stimulating production of IL-12 activity.EFFECT: strain is used as ingredient of medicinal agent for immune stimulation, agent against influenza virus, food product, beverage, fodder and agent stimulating production of IL-12.8 cl, 2 dwg, 3 tbl, 3 ex
ethod for producing pathogenic biological agent simulators // 2607369
FIELD: medicine.SUBSTANCE: invention relates to medical microbiology and sanitary epidemiology. Disclosed is a method for producing pathogenic biological agent simulators by processing the cell suspension of the exciter of dangerous infectious disease by microwave radiation with frequency of 2,450 Mhz, power of 6 w/cm3 twice for 5 minutes. Inactivated bacteria are being stabilized by the protective medium and dried in the sublimation chamber till residual humidity of 2–5 %. End product consists of dry culture of inactivated bacteria (91.5 %), talc (8) and aerosil (0.5 %).EFFECT: method provides a safe pathogenic biological agent long-preserving its indication simulator properties.1 cl, 2 tbl, 5 ex
ethod for evaluating contamination of periodontal by pathogenic bacteria using real-time polymerase chain reaction // 2607046
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry, clinical-laboratory diagnostic, in particular to determination of degree of contamination of periodontal pathogenic bacteria by PCR in real-time . Described a method of using complex test system for determining Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis and Treponema denticola, as well as the principle of use of the threshold value, making it possible to distinguish pathological bacterization of parodontium (able to cause the onset of periodontitis) from normal, occurring in the patients without manifested periodontal injury or tendency to it. Method involves PCR in real time for determining in the swabs of periodontal pathogens. Relative value of Ct for sample is determining by the following algorithm: from the averaged in two or more independent determination of absolute value Ct (defined by software thermocycler with an optical detection) for a specific set of primers and probe subtracted average value Ct of total bacterial mass for the same sample series, then identified pathological periodontal bacterization provided that value of relative Ct does not exceed 15.EFFECT: invention can be used for detection of causes of chronic periodontitis in individual patient, evaluating risk of occurrence of this disease in the future and clinical effectiveness as aggressive and chronic periodontitis.1 cl, 6 dwg
Viral vectors cleaning system // 2607044
FIELD: biotechnology.SUBSTANCE: disclosed is viral vector cleaning method. Method involves introduction of exogenous gene coding receptor and representing gene interest in packing cell line, followed by cells culturing, collection of supernatant containing viral vector particles carrying receptor on its outer shell. Subsequent supernatant incubation with ligand, connected with fragment, which can be extracted from supernatant, leads to ligand binding with receptor, as a result of which obtained ligand-viral vector complex can be extracted from supernatant to produce viral vector purified particles.EFFECT: proposed cleaning method is effective and provides high level of extraction, and can be used in biotechnology for viral vectors cleaning.15 cl, 3 dwg, 4 tbl, 6 ex
ethod for evaluating pyorrhoea on paradontium based on level of human interleukin-8 (il-8) gene mrna // 2607041
FIELD: medicine.SUBSTANCE: invention relates to medicine, dentistry, molecular biology and clinical-laboratory diagnostics. Described is a method of determining intensity of suppuration (pyorrhoea) of periodontal tissues. Method is based on measuring in scrapes from periodontium level interleukin-8 (IL-8) gene RNA relative to representation of reference RNA or DNA. Obtained parameters are used to calculate ratio of levels for each specific sample. Value of obtained parameter is interpreted as a marker of suppuration. Invention can be used to determine pyorrhoea in individual patients with aggressive and chronic paradontium, including after loss of tooth, in cases when intensity of said process does not allow visual detection of pus, as well as in tissues in contact with implants and other orthodontic structures.EFFECT: method provides highly sensitive and objective quantitative characteristic of degree of suppuration of analysed area of periodontium, which enables to evaluate risk of acute local inflammation and periodontium destruction in future, establish implants and other dental structures, evaluate effectiveness of therapeutic measures.3 cl, 4 tbl
Interaction prediction device, interaction prediction method and program product // 2607039
FIELD: biochemistry.SUBSTANCE: group of inventions relates to prediction of biomolecular binding. Disclosed is a method and an apparatus for predicting interaction between a compound and a protein, and energy-independent material of computer-readable data medium. Device includes a data storage unit and a control unit. Storage unit comprises a compound structure data storage unit and a protein structure data storage unit. Control unit comprises a compound structure data acquiring unit, protein structure data acquiring unit, a predicted protein determining unit and an interaction strength determining unit. Method includes a step of obtaining compound structure data, a step of obtaining protein structure data, a step of determining a predicted protein and a step of determining interaction strength. Data carrier comprises programmed commands to cause, upon execution thereof by apparatus, prediction of interaction.EFFECT: inventions enable to efficiently identify a biomolecule, such as protein, in which a possible compound interacts in a living body.8 cl, 16 dwg
Antigen-binding proteins // 2607038
FIELD: medicine.SUBSTANCE: invention relates to immunology. Method of producing antigen-binding protein and host cell for its production are proposed. Antigen-binding protein obtained using present invention includes: a) two modified heavy chains of antibody, in which VH of each heavy chain has been replaced for VL of said antibody and which are linked to each other via their CH3-domains of Fc-part; and b) two modified heavy chains of antibody, in which CH1 of each heavy chain has been replaced for CL of above antibody and which are linked to each other via their CH3-domains of Fc-part; wherein VL-domains of heavy chains a) are linked to VH domains of heavy chains b), and CH1-domains of heavy chains a) are linked to CL-domains of heavy chains b).EFFECT: obtained antigen-binding protein shows increased antibody-dependent cell mediated cytotoxicity (ADCC).14 cl, 12 dwg, 5 tbl, 10 ex
Nd2 peptides and methods of treating neurological disease // 2607033
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, specifically to identifying a core region of ND2 responsible for interacting with Src, and can be used in medicine. Peptides are obtained, no more than 20 amino acid residues ND2 region, containing residues 310-321.EFFECT: invention enables to obtain peptides inhibiting interaction ND2 with Src, that can be used for effective therapy of stroke and pain.15 cl, 23 dwg, 9 ex
ethod of detecting candidate genes for population research of genetic polymorphism in children dwelling in strontium geochemical province environment // 2607031
FIELD: medicine.SUBSTANCE: invention relates to biochemistry and medicine, namely to method of detecting candidate genes for population research of genetic polymorphism in children, dwelling in strontium geochemical province environment. To this end blood is sampled in children, living in strontium geochemical province no less than 3 years. From this sample DNA is recovered and library of short pieces of DNA is created. Their hybridization with set of preset primers is made, which represent liquid DNA-biochip. Then hybridized sections are subjected to sequencing, stating actual sequence of nucleotides, composing genes and comparing sequence with reference sequence of nucleotides in genes. Deviations are determined in sequence, taking such deviations as associated with possible child health disorders under action of strontium. As above genes are used: CYP1A2, TLR4, TERT, FAS, FOXP3, TP53, MTHFR, SULT1A1, VEGF, ZMPSTE, SOD, SIRT3, NOS3, PPARD and CPOX. In sequence of nucleotides of each of said genes number of single-nucleotide polymorphisms is identified, and presence of such polymorphisms in gene in amount of 6 and more shows connection of such changed gene with strontium exposure acting on child in conditions of strontium geochemical province environment. This gene is accepted as candidate gene for further study of population genetic polymorphism in children, dwelling in strontium geochemical province environment.EFFECT: present invention enables detection of candidate genes through genetic polymorphism in children, associated with effect of strontium, and further use of obtained information for population analysis for establishing at early stage of certain diseases, caused by disrupted gene.1 cl, 3 tbl, 1 ex
Cultivated hybrid animal cells of mus musculus l.-en-4c9 - producer of monoclonal antibodies against endoglin (cd105) // 2607029
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Strain of cultivated hybrid animal cells is disclosed, Mus musculus L. - EN-4C9 – which is producer of monoclonal antibodies against human endoglin (CD105). Strain is created as result of merging of cultivated cells of mouse myeloma SP-2/0 and splenocytes of mice-hybrids F1 (SJL/J x BALB/c), immunized with recombinant human endoglin. Obtained strain EN-4C9 is deposited in Russian collection of cell cultures of vertebrates (Institute of Cytology of RAS) under number RKKK (P) 771D.EFFECT: invention enables to obtain monoclonal antibodies against human endoglin with wide spectrum of application, in particular for detecting native endoglin on membranes of living and dead cells, as well as for determining concentration of endoglin in human blood serum by ELISA.1 cl, 5 dwg, 6 tbl, 6 ex
Strain of microorganisms achromobacter spanius 10-50-ts2 as agent improving plant resistance to chloride salinity // 2607028
FIELD: biotechnology.SUBSTANCE: invention relates to agricultural biotechnology. Invention represents strain of microorganisms Achromobacter spanius 10-50-TS2, deposited in Russian national collection of industrial microorganisms FGUPGosNIIGenetika under No. B-12405, as agent for increasing resistance of plants in conditions of chloride salinity of soils. Strain of bacteria Achromobacter spanius 10-50-TS2 No. B-12405 increases germination power of seeds by 40 % (p < 0.001), laboratory capacity by 35.2 % (p < 0.001), increases length of germs by 59 %, weight of seedlings in 2 times, increases number of roots by 13.3 %, root mass in 2 times under conditions of chloride salinity.EFFECT: higher resistance of plants.1 cl, 1 tbl
Biotransformation phenylmethyl sulphide in (r)-sulphoxide using immobilized cells gordonia terrae iegm 136 // 2607027
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, in particular to production of (R)-phenylmethylsulfoxide. Method involves oxidation of phenylmethylsulfoxide using biocatalyst-immobilized in cryogel of polyvinyl alcohol of cells Gordonia terrae IEGM 136. Process is carried out in mineral medium, containing n-hexadecane in amount not exceeding 0.1 vol. %.EFFECT: invention allows to increase output of the end product and optimize the process of its production.3 cl, 2 dwg, 3 tbl, 8 ex
Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle // 2607025
FIELD: veterinary science.SUBSTANCE: invention relates to veterinary virology and biotechnology, namely, to genetic engineering. There are offered synthetic oligonucleotide primers for identification of RNA atypical pestivirus of cattle and application method. Represented synthetic oligonucleotide primers have nucleotide sequences: SEQ ID NO: 1 - 5' tttgcagccgagcgtag 3', SEQ ID NO: 2 - 5' cctcctgcatactgtcacctt 3'. Disclosed method involves RNA recovery from embryonic sera samples and biological material, conducting reverse transcription and PCR with synthetic oligonucleotide primers, transfer of the amplification product on gel and evaluation the reaction. PCR is carried out in 1 round. In case of positive reaction enables synthesizing a fragment, corresponding to 320 p.n.EFFECT: invention can be used in veterinary science for detection of possible contaminations of embryo serums, used for cultivation of cell cultures and production of biopreparations, atypical pestivirus of cattle, as well as for diagnosis of infectious diseases in farm animals, in particular infection caused by atypical pestivirus of cattle.2 cl, 1 dwg, 3 tbl, 4 ex
Dry bacterial starter for production of fermented milk products and production method thereof // 2607023
FIELD: biotechnology.SUBSTANCE: declared group of inventions relates to biotechnology. Method of production of dry bacterial starter for production of fermented milk products involves separate cultivation of strains Streptococcus thermophilus KD7 41 №2 VKPM V-10403 and Streptococcus thermophilus ZL-047 VKPM V-10707. Fermentation of each strain is carried out to produce a liquid biomass. Carried out concentrating of the resulting liquid biomass of each strain, mixing of each strain with a protective medium at a ratio of 1:2–1:4 with further separate drying and mixing the obtained biomass Streptococcus thermophilus KD7 41 №2 VKPM V-10403 and Streptococcus thermophilus ZL-047 VKPM V-10707 in ratio of – 3:7 with producing dry bacterial starter.EFFECT: invention allows to extend storage life of starter in the high content of active living cells of starter and cut the duration of milk fermentation.4 cl, 1 ex
Test strain leptospira of interrogans serogroup icterohaemorrhagiae serovar copenhageni for detection of antibodies to l icterohaemorrhagiae // 2607006
FIELD: biotechnology; medicine.SUBSTANCE: invention relates to medical biotechnology and can be used for detection of antibodies to L. icterohaemorrhagiae. Test strain Leptospira interrogans of Icterohaemorrhagiae serogroup copenhageni serovar with evident antigenic and immunogenic properties is deposited in State collection of pathogenic microorganisms and cell cultures "GKPM-Obolensk" under registration number V-7745.EFFECT: invention provides serological diagnosis of leptospirosis, monitoring of distribution of icterohaemorrhaghic leptospirosis among people and among different species of animals.1 cl, 1 tbl, 2 ex
ethod of determining biological activity of measles, epidemic parotitis and rubella during production of associated preparations (versions) // 2606848
FIELD: biotechnology.SUBSTANCE: invention relates to medical biotechnology. Methods of determining biological activity of monocomponents in associated combined di-and trivaccines are disclosed, which contain vaccine strains of measles virus (l-16), epidemic parotitis (l-3) and/or rubella (Orlov).EFFECT: proposed methods make it possible to simplify technology of control of vaccine preparations and reduce cost of production of vaccines.3 cl, 5 tbl, 3 ex
Lactobacillus mucosae strain for producing fermented food products // 2606770
FIELD: food industry.SUBSTANCE: disclosed are Lactobacillus mucosae for producing fermented food products and a food product containing said strain. Lactobacillus mucosae strain is deposited in CNCM under number I-4429. Strain has capability to reduce permeability of intestinal barrier.EFFECT: invention can be used to alleviate conditions, including dysfunction of intestinal barrier, in particular conditions related to increase in permeability of intestinal barrier.3 cl, 5 dwg, 3 tbl, 5 ex
Plants expressing cell wall degrading enzymes and expression vectors // 2606766
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry, particularly to vectors for expression of proteins in plants. Disclosed are versions of a transgenic plant intended for expression of a cell wall degrading enzyme. Also disclosed are vectors for expression of said cell wall degrading enzyme in a transgenic plant. Invention also relates to a method of processing plant biomass, where plant biomass includes a transgenic plant according to invention.EFFECT: invention provides high enzymatic activity of hydrolytic cell wall degrading enzymes in transgenic plants and can be used for industrial and agricultural purposes.43 cl, 73 dwg, 6 tbl, 22 ex
ethod for producing polyploidized megakaryocyte and platelets // 2606764
FIELD: biotechnology.SUBSTANCE: invention relates to cell technology. Described are methods for producing polyploidized megakaryocyte and platelets, comprising forcing expression of a BCL-XL gene in megakaryocytes before polyploidization, said megakaryocytes are obtained by forcing expression of an oncogene such as MYC or a gene such as BMI1 in the cells at any differentiation stage from hematopoietic progenitor cells obtained not from ES cells, in megakaryocytes before polyploidization and cultivation and proliferation of the obtained cells, and cultivation the above cells.EFFECT: obtaining polyploidized megakaryocytes and platelets.14 cl, 24 dwg, 3 ex
Single nucleotide polymorphism on chromosome 15 enabling prediction of hcv treatment responses // 2606759
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is a method of predicting response of a person infected with hepatitis C virus (HCV), to therapy with peginterferon alpha-2a, ribavirin and antiviral agent of direct action. Method comprises providing a sample from said person and identifying nucleotide present at single nucleotide polymorphism rs12148487. Presence of at least one A allele at rs12148487 in said subject indicates a higher likelihood of rapid virological response in two weeks (RVR2) achieved by said subject to said treatment relative to a subject that has two G alleles present at rs12148487.EFFECT: invention enables to optimise treatment of patients with hepatitis C.5 cl, 6 dwg, 1 ex
Thromboembolic disease markers // 2606758
FIELD: biotechnology.SUBSTANCE: present invention relates to genetics. Method for evaluating of risk of thromboembolic episode occurrence or diagnostics or presence of such disease or episode, based on presence of serpin A10 (protein Z inhibitor) Arg67Stop (rs2232698), serpin C1 (antithrombin) Ala384Ser (Cambridge II), factor XII C46T (rs1801020), factor XIII Val34Leu (rs5985), factor II (prothrombin) G20210A (rs1799963), factor V Leiden Arg506Gln (rs6025), factor V Cambridge Arg306Thr, factor V306Hong Kong ArgGly, AB0 blood group rs8176719, blood group ABO rs7853989, rs8176743 and rs8176750. Besides, method is disclosed of identification of individual, requiring therapeutic treatment with anticoagulant and/or antithrombin, or preventive treatment with anticoagulant and/or antithrombin, based on presence of at least one allele of each of said polymorphous variants.EFFECT: present invention can find further application in therapy of thromboembolic diseases.7 cl, 2 dwg, 8 tbl, 1 ex
ethod (versions) for capturing particles of interest from mixture // 2606609
FIELD: biotechnology.SUBSTANCE: present invention relates to a method for capturing virus-like particles of interest from a mixture containing destroyed plant cells. Method comprises use of an expanded bed of adsorbent containing resin material, balancing resin material at pH 6.0–8.0 and adding mixture to expanded bed of adsorbent for binding of virus-like particles. Degree of expansion of expanded bed is equal to 1–5. Further, adsorbent is washed. Virus-like particles are eluted from adsorbent.EFFECT: high purity of extracted particles, high process efficiency.17 cl, 9 tbl
ethod of modification of polypeptide for purification of polypeptide multimers // 2606264
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and represents method of polypeptide multimer production, which includes first polypeptide with antigen-binding activity and second polypeptide with antigen-binding activity or in addition to first and second polypeptides multimer includes one or two third polypeptides with antigen-binding activity or in addition to first, second and third polypeptides multimer includes fourth polypeptide with antigen-binding activity; and method involves following steps: (a) expression of DNA, which codes first polypeptide with antigen-binding activity, and of DNA, which codes second polypeptide with antigen-binding activity, or expression of DNA, which codes first, second and third polypeptides with antigen-binding activity, or expression of DNA, which codes first, second, third and fourth polypeptides with antigen-binding activity; and (b) assembling of expression product of stage (a) using affinity chromatography with protein A.EFFECT: invention enables to obtain multimers with antigen-binding activity of high purity as a result of only purification step, based on protein A.44 cl, 18 dwg, 18 tbl, 12 ex
ethod of light beer production // 2606260
FIELD: food industry.SUBSTANCE: invention relates to beer production method. Method envisages light malt mashing with unmalted grain, previously processed by extrusion, produced wort filtering, boiling with granulated hop; wherein before mashing unmalted raw material is subjected to extrusion treatment in press-extruder at pressure of up to 60 atmospheres and temperature of up to 150–200 °C using corn and siberian millet extrudates by 5–10 % of each component of raw material total amount.EFFECT: method provides more effective starch hydrolysis and reduced duration of afterfermentation.1 cl, 3 tbl, 2 ex
Agent for stimulation of reparative osteogenesis // 2606257
FIELD: medicine.SUBSTANCE: invention relates to medicine, namely to use of preparation "Vinfar" as agent for stimulation of reparative osteogenesis in treatment of open fractures of extremity bones by intramedullary osteosynthesis.EFFECT: above solution enables stimulation of reparative osteogenesis, which leads to reducing length of callus formation and regeneration of bone in average by 7 days.1 cl, 4 dwg, 1 ex
Strain of nodular dermatitis virus of cattle dermatitis nodularis bovum, genus capripoxvirus to produce biopreparations for diagnosis and specific prevention of nodular dermatitis of cattle // 2606254
FIELD: veterinary science.SUBSTANCE: invention relates to veterinary virology and biotechnology and concerns strain of virus nodular dermatitis of cattle (VND CATTLE). Described strain is recovered from cows, patients of nodular dermatitis, and deposited in Collection of strains of FGBU "VNIIZT" under registration number - VND KRC/Dagestan/2015 (diagnostic). Strain is reproduced in cultures of cells YDK-04 and TY during 2÷3 days and accumulated in titre from 4.5 to 5.5 lg TCD50/cm3, preserves initial characteristics when passaging in cultures of cells YDK-04 and TY during 5 passages.EFFECT: obtained on its base antigen material can be used for making diagnostics and specific prevention of nodular dermatitis CATTLE.1 cl, 5 dwg, 6 tbl, 7 ex
Oligonucleotide primers and fluorescent probe with inner damper, complementary to the gene section p30 (cp204l) of the african swine fever virus, for use in polymerase chain reaction in real time // 2606253
FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology, namely, to synthetic oligonucleotide probes and primers for detection of DNA of african swine fever virus. Offered synthetic oligonucleotide primers and fluorescence marked probe with inner damper complementary to the conservative region of the gene P30 (CP204L) of the african swine fever virus and have the following nucleotide composition: F1 p30 5'-GTTACGACCGCTATAAAAACA-3'; R1 p30 5'-TTCCATTCTTCTTGAGACCTG-3'; Z1 (int) p30 5'-(FAM)TACTGTT(RTQ1)AAGTATGATATTGTGA(BHQ1)-3'.EFFECT: proposed invention can be used in gene diagnostics of infectious diseases of pigs and veterinary virology.1 cl, 4 tbl, 2 ex
Strain of influenza virus a/common muskrat/chany lake/226/05 h2n2-subtype for use in diagnostics of influenza virus by methods of rtga and pcr and studying efficacy of antiviral preparations in vitro and in vivo // 2606030
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and concerns influenza virus strain. Presented strain of virus of bird flu A/Common Muskrat/Chany Lake/226/05 H2N2-subtype, deposited in collection of microorganisms of Federal budgetary institution of science "State Research Centre for virology and biotechnology "Vector" under registration number V-623.EFFECT: invention can be used to study the efficacy of therapeutic and preventive preparations for influenza, for preparation of antigen-containing substrate and serum for serodiagnosis of influenza H2-subtype in RTGA, for use as a control reference sample when evaluating specificity of test systems based on polymerase chain reaction, as well as for studying efficacy of antiviral preparations in vitro and in vivo.1 cl, 4 tbl, 4 ex
ethod of barley-and-wheat malt producing // 2606029
FIELD: technological processes.SUBSTANCE: invention relates to production of malt from barley and wheat mixture. Method involves preparing barley and wheat mixture in ratio of 1:1, washing mixture with tap water for 4–8 minutes, mixture soaking in anolyte with pH of 3.0–6.0 units and redox potential of 970–1,110 mV, oxygen concentration of 8.3–12.0 mg/l and chlorine of 0.006–0.01 mg/l for 3.5–4.5 hours with grain mixture to anolyte ratio of 1:2, grain mixture re-washing with tap water for 3–8 minutes, germination of grain mixture by air spraying method for 96–120 hours with periodical turning, sprouted grain mixture drying.EFFECT: method provides malting process simplification, reduction of its duration and obtaining barley-and-wheat malt with recommended biochemical and microbiological quality parameters.1 cl, 1 tbl, 1 ex
Reassortant influenza virus strain a/17/silver gull/sarma/06/887 (h6n1) for preparing live influenza vaccine // 2606026
FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology and concerns influenza virus strain. Proposed a reassortant vaccine strain A/17/silver gull/Sarma/06/887 (H6N1). Strain is produced by crossing virus A/Silver gull/Sarma/51c/2006 (H6N1) with strain A/Leningrad/134/17/57 (H2N2) – donor of attenuation, harmless for adults and children. Strain A/17/silver gull/Sarma/06/887 (H6N1) actively propagates in developing chicken embryos at optimal temperature 33 °C, is characterised by heat sensitivity, cold adaptation and attenuation and immunogenicity for laboratory animals. Strain is deposited in the State collection of viruses FSBU of federal State Research Centre of epidemiology and microbiology of the honorary academician N.F. Gamaley of Ministry of health of the RF at № 2807.EFFECT: invention can be used for producing live influenza vaccine.1 cl, 1 dwg, 2 tbl, 2 ex
ethod for production of wheat and rye malt // 2606024
FIELD: food industry.SUBSTANCE: invention relates to production of malt from wheat and rye. Method comprises preparation of malt mixture from wheat and rye grains in ratio 1:1, washing wheat and rye grains with tap water for 4–8 minutes, soaking in an anolyte with pH 3.0–6.0 and redox potential 970–1,110 mV, oxygen concentration 8.3–12.0 mg/l and chlorine concentration 0.006–0.01 mg/l for 3.5–4.5 hours with ratio of grain mixture to anolyte 1:2, after soaking in anolyte repeated washing of grain mixture with tap water for 3–8 minutes, sprouting grain mixture of wheat and rye using an air-spraying method for 96–120 hours with periodical turning, drying sprouted grain mixture.EFFECT: method enables to obtain quality wheat-rye malt using a simple malting process and shorter duration thereof, as well as obtaining malt mixture with recommended biochemical and microbiological properties of quality.1 cl, 1 tbl, 1 ex
Composition of ingredients for kvass "vyatsky" // 2606023
FIELD: food industry.SUBSTANCE: invention relates to composition of ingredients for kvass. Composition comprises content of yeast, granular sugar, rye malt, barley malt, rye flour and water in following ratio, kg/100 dal of end product: yeast – 0.1–0.3; granular sugar – 60–75; rye malt – 11–15; barley malt – 10–13; rye flour – 9–12; balance is water.EFFECT: composition provides wider range of obtained kvass, improves its stability during storage with simultaneous production of balanced soft taste with low acidity and natural fermentation of carbon dioxide.1 cl, 1 dwg
ethod of producing capsular polysaccharide with pneumococcal serotype // 2606022
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology. Method of producing capsular polysaccharide with pneumococcal serotype is disclosed. Bacterial cells are cultured at culture fluid pH in range of 7.0 to 9.4. Then cultivation is stopped at the moment between culture fluid absorption coefficient is constant and absorption coefficient begins to fall. Additional cultivation is performed without pH regulation until culture fluid pH reaches value of 5.5 or less. Then lysing agent is added to obtained culture fluid for cell lysis. Precipitated proteins and cellular debris are removed to obtain purified cell lysate. Capsular polysaccharide is separated and purified from obtained lysate.EFFECT: invention eliminates process of depositing protein by increasing acidity by means of pH regulator, which simplifies process and does not lead to modification of capsular polysaccharide and formation of hazardous substances.13 cl, 6 dwg, 10 tbl, 3 ex
ethod of producing barley malt // 2606020
FIELD: technological processes; food industry.SUBSTANCE: invention relates to a method of producing barley malt. Method comprises washing grains with tap water for 4–8 minutes, soaking in an anode with pH 3.0–6.0 and redox potential 970–1,110 mV, oxygen concentration 8.3–12.0 mg/l and chlorine concentration 0.006–0.01 mg/l for 3.5–4.5 hours at ratio of grains to anolyte 1:2, after soaking in an anode repeated washing of grains with tap water for 3–8 minutes, germination of barley grains by air spraying method for 96–120 hours, after which germinated grains are dried.EFFECT: method enables to obtain quality barley malt by simplifying malting process and reduction of its duration, as well as obtaining barley malt with recommended biochemical and microbiological properties of quality.1 cl, 1 tbl, 1 ex
Vaccine influenza virus strain a/17/hongkong/2014/8296 (h3n2) for preparing live influenza intranasal vaccine for adults and children // 2606019
FIELD: medicine.SUBSTANCE: invention refers to medical virology and concerns influenza virus strain. Disclosed a vaccine strain A/17/Hongkong/2014/8296 (H3N2)-reassortant, produced by crossing "wild" virus A/Hongkong/4801/2014 (H3N2) with cold-adaptive heat-sensitive virus A/Leningrad/134/17/57 (H2N2) – attenuation donor, safe for humans. Presented strain A/17/Hongkong/2014/8296 (H3N2) actively propagated in chicken embryos at optimal temperature of 32 °C, characterized by temperature sensitivity and cold adaptation and safety for laboratory animals. Strain is deposited in the State collection of viruses FGBU "FNICEM nam. N.F. Gamalei" of the Ministry of Health of Russia, Institute of virology nam. D.I. Ivanovskogo under № 2818.EFFECT: invention can be used in practical health services for preventing influenza incidence in adults and children by a live influenza intranasal vaccine.1 cl, 1 dwg, 5 tbl
Aldehyde marked immunoglobulin polypeptides and methods of their application // 2606016
FIELD: biotechnology.SUBSTANCE: present invention relates to biotechnology, namely to producing aldehyde marked antibody for conjugation with drug of interest, and can be used in medicine. Obtained antibody can be modified with formylglycine-forming enzyme to make 2-formylglycine modified (FGly) antibody, which can be covalently and site specificly is conjugated with target fragment.EFFECT: invention enables to obtain conjugate, capable of directed delivery in antigen expressing body tissues.60 cl, 33 dwg, 3 ex
 
2551347.
Up!